Which of the following is NOT a characteristic of active transport? *
A)It moves substances against a concentration gradient
B)It requires energy from the cell
C)It involves facilitated diffusion
D)It may use carrier proteins that often function as the sodium potassium pump

Answers

Answer 1

Answer:

It involves facilitated diffusion.

Explanation:

Facilitated diffusion uses channel proteins. Channel proteins allow substances to travel through a membrane going with the gradient. Since active transport goes against the gradient, facilitated diffusion would not be a characteristic of it.


Related Questions

Please put the following in order from Least Inclusive to MOST inclusive...

Organs Molecules Organ Systems
Organism Cells Tissue

A) Organism -> Organ Systems -> Organs -> Tissue -> Cells -> Molecules
B)Atoms -> Cells -> Molecules -> Organs-> Organ Systems -> Organism
C) Molecules -> Cells -> Tissue -> Organs -> Organ Systems -> Organism
D) Cells -> Organism-> Tissue -> Organ Systems -> Molecules -> Organs

Answers

Definitely C. A has it reversed, B includes atoms and puts molecules after cells, and D puts organisms right after cells

What are the differences between the Big Bang Theory and the Steady State Theory?

Answers

Answer

One is a move and the other is a part of a state.

Explanation:

Answer:

The only difference, he explained, was that in the big bang scenario all the matter was created in one explosive beginning.

In the outer layer of the sun, energy is transported outward by the rising of hot plasma and sinking of cooler plasma. This transfer is known as

Answers

Answer: Convection.

Explanation:

We have 3 types of heat transmission.

Radiation: Heat is transported as electromagnetic waves, this is not the case shown here.

Conduction: When we have two objects with different temperatures and we put them in contact, the system will want to go to equilibrium (both objects have the same temperature) so the hot object will give heat to the cooler object. We usually see this with solid objects.

Convection: It is the heat transfer due to the bulk movement of the molecules, so this need a material medium (it can not take place in solids, because the position of the molecules is fixed in the solids).

Then the rising of hot plasma and sinking of cooler plasma is convection.

Write a one-paragraph essay that summarizes the relationship between chloroplasts and
chlorophyll, making sure to include how they work together in photosynthesis.

Answers

Answer:

New algorithms for estimating chlorophyll-a in the Spanish waters of the Western Mediterranean Sea from multiplatform imagery This manuscript proposes a set of multi-sensor chlorophyll-a empirical algorithms for improving current estimates of chlorophyll-a concentration in two distinct regions in the Mediterranean Sea.

Many studies in the area of cancer research are opening up new possibilities for cures and prevention measures.  One area of research is directed at the effects that chlorophyll may have on cancer cells within the human body.  Research is being conducted to investigate whether chlorophyll has important cancer fighting factors that may play a role in the destruction of cancer cells or whether it is an effective preventive agent.  

Daily supplements of the chlorophyll derivative, chlorophyllin (CHL) can provide a way to prevent cancer by reducing DNA damage  (Arbogast, 1995).   The chlorophyllin copper complex (CHL) is a water-soluble version of chlorophyll and is a semi-synthetic prepared substance.  CHL is the most common chlorophyll derivative used for cancer related studies  (Chernomorsky, 1999).  Most research was done using chlorophyllin because chlorophyll is chemically modified to chlorophyllin in the body during digestion. Chlorophyllin given in amounts to that of chlorophyll were equally effective in the studies  (Sarkar, 1994).  CHL can be added to the diet very easily and may be safe and useful for effective prevention of cancer  (Arbogast, 1995).

Explanation:

Hope this is what you wanted.

What field of forensics do medical coroners work in?
O Forensic sociology
O Forensic pathology
O Forensic entomology
O Forensic psychiatry

Answers

the answer should forensic pathology :) my apologies if wrong but that should be it

Answer:

THE ANSWER is B

Explanation:

i need to poop

Question 6 of 20
A girl swings a yo-yo around in circles. How can she increase the total energy
of this system?
O
A. Reverse the direction of the swing,
O
B. Stand on a table while swinging the yo-yo.
C. Sit on the ground while swinging the yo-yo.
о
D. Swing the yo-yo at a lower speed,
SUBMIT

Answers

Answer:

it's B

Explanation:

A girl can increase the total energy of this system by standing on a table while swinging the yo-yo. Thus, the correct option is B.

What is Yo-yo?

Yo-yo may be defined as a type of toy that consists of a pair of joined discs with a deep furrow between them in which thread is attached and wound.

By reversing the direction of the swing, swinging the yo-yo at a lower speed, and sitting on the ground while swinging the yo-yo decrease the total energy of the system. This is because the system does not have the momentum that is required to increase its overall energy.

Therefore, a girl can increase the total energy of this system by standing on a table while swinging the yo-yo. Thus, the correct option is B.

To learn more about Total energy of the system, refer to the link:

https://brainly.com/question/478253

#SPJ5

The field of Astronomy is not related to technology
O True
False

Answers

Answer:

false

i hope this helps and goodluck!

At what temperatures can monarch fly?

Answers

Answer:55 degrees

Explanation:In order for an adult monarch to fly, temperatures need to be above 55 degrees Fahrenheit.

Answer:

Temperatures need to be above 55 degrees Fahrenheit.

Explanation:

Which of the following is an example of a complex machine?
1. Pulley
2. Wedge
3. Scissors
4. Incline

Answers

3- Scissors are an example of a complex machine.

Answer:

A :3

Explanation:

Just did acceleratted ed. Hope this helps!

please help me, 50 points

What type of bond are the arrows pointing to below in the picture


Answers

Thats is euther hydrogen bond or oxyegn bond. Im leaning towards hydrogen bond

Consider the plant cells in the image below. What is a function of the cell structure that is labeled x?

Answers

Answer:

c) It provides support to the plant

Answer:c

Explanation:

Choose one carbon sink and explain how the carbon gets out of it.

Answers

Answer::

Explanation:

Match each mineral property to the correct description.
crystal system
the ability to attract certain metals
cleavage
the number and angle of crystal faces
magnetism
the ability of a mineral to break along flat
surfaces
fracture
an irregular way of breaking apart
fluorescence
the ability to produce a visible glow

Answers

Answer: here you go hope this helps

Explanation:

Matching each mineral property to the correct description is:

crystal system

the number and angle of crystal faces

cleavage

the ability of a mineral to break along flat surfaces  

magnetism

the ability to attract certain metals

fracture

an irregular way of breaking apart

fluorescence

the ability to produce a visible glow

A mineral property are those things that make up or characterize a mineral. For example, things like crystal forms, luster, color, etc are all ways to recognize a mineral.

Read more here:

https://brainly.com/question/6736830

Dependence and Addiction are the
same thing?
a. True
b. False​

Answers

Answer:

b

Explanation:

one is a necessity, the other is a struggle

What’s the answer ????????

Answers

it’s d
i looked it up and it’s the exact same:)

Answer:

D: Electrons are transferred from one atom to another.

Explanation:

Protons are not involved in the covalency, and C, electrons are shared between two atoms, is the definition of a covalent bond, such as water. Ionic bonds form when two atoms, share (transfer) electrons to one another in order to fill the outer electron ring.

Hope this helps!

which statement best describes the forces in the picture?
a. The applied force in the force of friction are balanced.
b. all four forces are the same size.
c. all four forces are acting in the same direction.
d. The applied force in the force of friction are unbalanced.​

Answers

Answer: Its A.

Explanation:

None

The applied force and the force of friction are balanced in the picture because of which the person is standing still. Therefore option (A) is correct.

What is force?

A change in the force that is applied to an item with mass will cause that thing to move at a different speed. A body's state of rest or motion can be altered by the application of an external agent known as force. It is significant in both magnitude and direction.

The term "frictional force" refers to the force that is produced when two surfaces come into contact with one another and then slide against one another. A few factors that affect the force of friction are as follows: These forces are primarily influenced by the surface texture as well as the amount of force that is drawing them closer together.

Learn more about force, here:

https://brainly.com/question/13014979

#SPJ5

NEED ASAP


Which quality would make the question "What will make cows produce more milk?" a good scientific question for a
biologist to investigate?
A) It is about living things and is testable.
B) It will help consumers save money.
C) It will lead to new technology to gather milk.
D) It is a question that can have many answers.

Answers

Answer:

D

Explanation:

The scientist could find new tech, which could lead to lower prices, also, it is about living things and testable, so it would be many answers.

Example of reproduction

Answers

Answer:

a deer giving birth to a baby deer

Which of the following correctly identifies the function of the cell membrane?
A
controls what enters and leaves the cell
B
produces protein and enzymes
C С
controls the cell function
D
stores genetic infromation for the cell

Answers

Answer:

a controls what enters and leaves the cell

Explanation:

Cells are the basic unit of life. Some cells are single-celled organisms and others
are specialized to do a specific function for an organism. Even though cells are
structurally different depending on the organism, all cells have this in common?
A. The presence of nucleic acid
B. The absence of a nuclear envelope
C. The presence of a cell wall
D. The absence of ribosomes

Answers

Answer:

A. The presence of nucleic acid

Explanation:

what are thylakoids? I will give BRAINLIEST!!

Answers

Answer:

each of a number of flattened sacs inside a chloroplast, bounded by pigmented membranes on which the light reactions of photosynthesis take place, and arranged in stacks or grana.

Thylakoids are membrane-bound compartments inside chloroplasts and cyanobacteria. They are the site of the light-dependent reactions of photosynthesis. Thylakoids consist of a thylakoid membrane surrounding a thylakoid lumen. Chloroplast thylakoids frequently form stacks of disks referred to as grana.

Explanation:

Answer:

They are membrane-bound compartments inside chloroplasts (the food producers of the cell) and cyanobacteria (group of photosynthetic bacteria).


What problems can pseudoscience cause for society?

Answers

Answer:

It is quite difficult to picture a pseudoscientist—really picture him or her over the course of a day, a year, or a whole career. What kind or research does he or she actually do, what differentiates him or her from a carpenter, or a historian, or a working scientist? In short, what do such people think they are up to?

… it is a significant point for reflection that all individuals who have been called “pseudoscientists” have considered themselves to be “scientists”, with no prefix.

The answer might surprise you. When they find time after the obligation of supporting themselves, they read papers in specific areas, propose theories, gather data, write articles, and, maybe, publish them. What they imagine they are doing is, in a word, “science”. They might be wrong about that—many of us hold incorrect judgments about the true nature of our activities—but surely it is a significant point for reflection that all individuals who have been called “pseudoscientists” have considered themselves to be “scientists”, with no prefix.

Which of the following is a term use to describe a mound, hill of ridge of wind-blown sand?
A.peak
B.hill
C.contour
D.dune​

Answers

The answer is D.dune

science is so confusing to me!

Select all answers that are correct.

If people have never observed matter (mass) to be created or destroyed, then using inductive reasoning, it would be logical to conclude that:


the known laws of science cannot account for the origin of mass
the amount (quantity) of mass in the universe has never changed
the mass of the universe must have created itself

Answers

Answer:

second one.

Explanation:

not sure but it's the only answer that goes with the other laws

A location's weather depends on...
Question 1 options:
A. temperature
B. clouds
C. precipitation
D. all of the above

Answers

Answer:

D

Explanation:

its obvious

Answer:

D all of the above

Explanation:

The temperature is the heat or cold in the weather.

The clouds can change the temperature in the weather.

Precipitation is what most people think of when you say weather.

A cell membrane has permeability, which means that the membrane:

Answers

Answer:

transport proteins are specific and selective for the molecules they move, and they often use energy to catalyze passage.

Explanation:

I barley know what your trying to say

What does “denature” mean in terms of protein structure?

Answers

Explanation:

Denaturation, in biology, process modifying the molecular structure of a protein. Denaturation involves the breaking of many of the weak linkages, or bonds (e.g., hydrogen bonds), within a protein molecule that are responsible for the highly ordered structure of the protein in its natural (native) state.

*MAY* give brainliest!

Please give answer and explain:

This sequence encodes for a particular protein that helps bacteria move. A mutation occurs in the sequence, leading to a faulty protein. Identify the sequences where the mutation might have taken place.

ATTTGCATACTACCGGGC

The letters in bold with a yellow highlight are the noncoding region, and the other letters are the protein coding region.

Group of answer choices

ATTTGCAATACTACCGGGC

ATGAATGCATACTACCGGGC

ATTTGCATACTGACCGGGC

ATTTGCAACTACCGGGC

ATTAGCATACTACGGGC


Highlighted letters are: ATACTACC

Answers

Answer:

1 and 5

Explanation:

https://brainly.com/question/11362587?utm_source=android&utm_medium=share&utm_campaign=question

Answer:

1.ATTAGC(ATACTAC)GGGC

5. ATGAATGC(ATACTACC)GGGC

Explain the law's of segregation and independent assortment.

Answers

Answer:

The law of segregation states that the two alleles of a single trait will separate randomly, meaning that there is a 50% either allele will end up in either gamete. This has to do with 1 gene. The law of independent assortment states that the allele of one gene separates independently of an allele of another gene.

Explanation:

I know it late but can u plz mark me brainliest?

Which of the following is caused by bad genes? *

Carcinoma
herpes
athlete's foot
vitaligo
bubonic plague

Answers

The answer is Vitaligo because all of the other answers are ones that you develop and not something you’re born with
Other Questions
In order to establish the Ming dynasty in China, Hongwu first had to drive out the what happen if you don't make enough electricity? what happens if you make too much? An atom of tin has an atomic number of 50 and a mass number of 119. How many protons, electrons, and neutrons are found in one neutral atom of tin?A.50 protons, 69 electrons, 50 neutronsB.50 protons, 50 electrons, 69 neutronsC.69 protons, 50 electrons, 69 neutronsD.69 protons, 69 electrons, 50 neutrons Write a quadratic function in standard form with zeros 3 and 9 plzzzz helppp meee Identify the line of reflection,PLEASE HELP ITS DUE IN 3 minutes!!! ____________________ _____________________ bYE dAD yOu waS SuS aNyWAys CWhat was the Domesday Book?O It contained a record of all the details from the battles the king won.o It was a religious text that guided the rule of the pope and the monarchs.O It was informational book about the churches and monasteries in England and France.O It was the result of a survey that gathered a detailed description of all land owned in England. One yardstick for measuring how steadilyif slowlyathletic performance has improved is the mile run. In 1958, the local record for the running of a certain distance was 3 minutes, 59.3 seconds, or 239.3 seconds. In the half-century since then, the record has decreased by 0.5 seconds per year. I have no idea what to do here How did Grant contribute to the loss of confidence in American politician? How do you find the unit rate? Write the number 352 in expanded form. *yaranswer what are smart word for an language art essay In Captain Canot, or Twenty Years of an African Slaver, how does the author develop the central idea that the health of enslaved captives was important to slavers? A. by explaining how a captives condition was assessed B. by suggesting that captives led poor lives in Africa C. by analyzing the day-to-day activities aboard a slave ship D. by describing how captives were loaded on the ships The Great Rift Valley is being formed by tectonic plates that are pulling away from each other. What would we expect eastern Africa to look like tens of millions of years in the future as a result of this activity?A.A large mountain range will be created along the rift.B.Eastern Africa will continue to move closer to South America.C.A sea will split the eastern coast of Africa from the rest of the continent.D.The continent will look about the same. Spain's first settlements in Georgia were what term refers to the horizontal layers of soil ___ is a vertical cross-section view of the different ___, which are parallel to the surface.soil bandssoil horizons soil layers POSSIBLE POINTS 50Solve the following problem using the checklist below.2. Jonathan buys equipment to print his own pictures. The equipment cost him $178 and it will cost him $0.17 for each picture he prints. The photo storecharges $0.39 per photo. How many photos does Jonathan need to print with his own equipment to begin to save money? I need to make I am right so, which is more -9 8/9 or -10 8/9 which quotient is larger? 1123 or 713