What is the broken classical period?

Answers

Answer 1

Answer:

it's a period between roughly 1730 and 1820

Explanation:


Related Questions

Which of the following describes parallel, overlapping lines going both directions?
O expressive
O hatching
O crosshatching
O stippling

Answers

Answer: crosshatching

Explanation:

Crosshatching.

Stippling is smaller dots, and expressive is an adjective for a mood or feel, not a technique.

To send the voice out into the audience is called ______________.
Group of answer choices

projection

articulation

larynx

resonance

Answers

The answer is indeed projection. :)

what is Gothic period

Answers

Answer: The period of dark writing such as The Castle Of Otranto

Explanation:

It involves themes such as

Mystery and fear

Omens and curses

Eerie atmosphere

Castles

A damsel in distress

A connection with the unknown such as ghosts of vampires

Dreaming and/ or nightmares

Who is the most attractive btd guy (its ren hana btw so please say ren hana)

Answers

Ren hana definitely maybe :)

"Water Walk" by John Cage is this music why or why not

Answers

Answer:

For solo television performance involving a large number of properties and a special single-track tape, 7.5 i.p.s. In one of his manuscripts, Cage indicated a subtitle for Water Walk as Water Music.

weWhich of the following sentences is correct? A. We will arrive, we will play, and win. B. We will arrive, we will play, and we will won. C. We will arrive, we will play, and we will win. D. We will arrive, we will play, and won.​

Answers

Answer:

C. We will arrive, we will play, and we will win.

Explanation:

It’s C
Brainliest plzzz

Your classmate Katrina is struggling with her paintings. She tries to make the important objects in her pieces stand out, but they always end up blending in. Her classmates can never tell what she is trying to emphasize in her works. She asks you if there is a specific principle she can work on to improve her paintings. After evaluating Katrina’s situation, what do you conclude is the BEST principle for her to work on?

A.
movement

B.
proportion

C.
harmony

D.
dominance

Answers

Answer:

would go with B and C  

Explanation:

because I always try to keep everything proportionate and balanced when painting. I also use harmony to keep things in order also but if your really having problems with painting and doubting yourself when it comes to stuff like this you shouldn't stress out about it because sooner or later away of painting will come to you and you won't be having to ask people like me for help. don't know how this helped but hope it did.

Important objects in the paintings

It helps in describing

different objects, patterns and textures.

How can she improve her paintings?

A painting is made up of different elements. Correct detailing in a painting is important to make it look living. In order to improve her paintings, she should focus on option B and C, i.e, proportion and harmony.

How proportion and harmony is important in paintings?

Proportion will help her in using correct ratio of colours and harmony will help her paintings look visually satisfying by combining

colors, shapes and patterns

in a correct way. This will improve her paintings.

Learn more about paintings here - https://brainly.com/question/23000015

#SPJ2

PLEASE HELP I NEED THIS TO PASS MY CLASS

1. Briefly describe in your own words what the term “treatment” means. After you have provided a brief description, give an example of how you could use a treatment in animation.

Answers

If you don’t like this answer, you can use QuillBot to rephrase the answer


The term "treatment" refers to a detailed outline or plan for a project, often used in the entertainment industry. It can include a summary of the plot, character descriptions, themes, and proposed visual style.

In animation, a treatment might be used to pitch an idea for a new animated film or television series. For example, a treatment for a children's show about a group of animal friends living in a forest might include descriptions of the main characters (such as a wise old owl, a mischievous raccoon, and a timid bunny), a summary of the overarching story arc (where the animals learn valuable lessons and solve problems together), and examples of the visual style (such as colorful, hand-drawn animation with anthropomorphic characters). The treatment would serve as a detailed guide for the production team as they bring the project to life.

Answer: Treatment means the act or manner or an instance of treating someone. Treatment can also mean the application of medicines, surgery, a patient or a disease or symptom

https://youtu.be/7dzkS0ioqqw

Explanation:

What is the professional meaning of abstract.

Answers

Answer a short summary of a longer work

Explanation:An abstract is a short summary of a longer work (such as a thesis, dissertation or research paper). The abstract concisely reports the aims and outcomes of your research, so that readers know exactly what your paper is about

How can discussions,projects, campaigns, and events support victims of human right violation

Answers

Answer:

There are plenty of ways & reasons that you can support victims of any sort.

Explanation:

By producing extravagant projects, building large campaigns, or even starting something as simple as a walk for support/charity. By doing so, you're allowing people to engage and learn what is wrong with the situation, and hopefully help address the victims in need.

1. The various characteristics that make up a person on the inside and outside are called
A. visual art.
O B. culture.
O C. diversity.
O D. identity.

Answers

Answer:

identity

Explanation:

can you carry a single sided butterfly knife in Michigan

Answers

Answer:

Butterfly knives, also called balisong knives, are legal. Dirks, daggers, stilettos, and other stabbing knives are legal.

ASAP!!!! NEED HEPL
Which of the following is the primary benefit of being a solitary artist?


collaboration


more income


lack of contractual obligations

flexibility

Answers

Answer:

More income.

Explanation:

If a artist works alone, he will not have to pay other people and will get more money for his own work, rather then others Hope this helps

When you actively listen, you show the speaker that you understand what they are saying. Responses True or False

Answers

True.

It's respectful to pay attention to what they're saying.

Answer:

True

Explanation:

The person speaking can sense that you're listening and trying to understand them, which makes them feel worth talking to you.

The industrial revolution brought about changes to theatre! Which of the following was NOT introduced during this time?
O Elipsoidal Light
O the incandescent bulb
O Limelight
O The arc light
O Gas Light

Answers

Answer:

The Ellipsoidal Light

Explanation:

The Ellipsoidal light was introduced in 1933, long after the industrial revolution in the 1800s.

(The Godfather) In the “horse scene,” what makes this scene so effective? We never see the act of what happens. How does Coppola use music, color, texture, voice, and editing to both prepare and shock us?

Answers

Answer:

Music, voice, etc have a large affect on what we think about what we hear and see. For instance, go to Y o u T u b e and search same video different music.

Explanation:

Giotto broke medieval traditions by?

Answers

Answer:

by drawing from the physical world and paintings scenes that were much more naturalistic

Answer:

Yep the answer up theres correct so say thanks to the person!!!

:)

What was the broken classical period about?

Answers

Answer:

a classical period

Explanation:

Put the vocal process in order from bottom (first part) to top (last part).

Answers

Answer:

okay pretend there's a number next to each one so I can effectively give you the answer (like 1, 2, 3, and 4) anyways, it's 3 first, 1 is second, 4 is third, and 3 is last. if it's easier to imagine there are letters beside them, it would go (in the order of the alphabet) c, a, d, then b. hope this helps.

What are the visual elements of art and principles of art based on the painting of "The Persistence of Memory " by Salvador Dalí?


I have a hard time answering this question and it is hard for me to put words in an artistic way. Please help me with this question!

Visual elements of art: line, shape, form, value, space, color, texture

Principle of art: rhythm, balance, emphasis (contrast), proportion, gradation, harmony, variety, movement

(I need 5 of Visual elements of art and Principle of art)

Answers

Answer:

The visual elements of art present in Dalí's painting are color, line, shape, value, and texture. The principles of art based on the painting are unity, variety, balance, rhythm, and emphasis.

Elif can produce 8 cakes or 80 cookies in 1 hour. Burak can produce 10 cakes or 20 cookies in 1 hour. a) Draw the PPF lines for Elif and Burak. b) If each spends 30 minutes of each hour for producing cakes and 30 minutes for producing cookies, how many cakes and cookies does each produce? c) What is the opportunity cost of producing cakes for Elif? What is the opportunity cost of producing cakes for Burak? d) What is the opportunity cost of producing cookies for Elif? What is the opportunity cost of producing cookies for Burak? e) Who has a comparative advantage in producing cakes and who has a comparative advantage in producing cookies? f) On the PPF lines, show what Elif produces and what Burak produces when they specialize. g) Suppose that they set the exchange price as 1 Cake
=5
Cookies. If they specialize and trade, show an exchange situation that is beneficial for both (compared to the situation you found in part (b))? 2- (10 pts) a. What are the factors that affect the supply of a good or service? b. What are the factors that affect the demand of a good or service? 3-

Answers

For Elif:

(0,80) (8,0)

For Burak:

(0,20) (10,0)

How calculate this?

a) To draw the PPF lines for Elif and Burak, we can use the information given about the number of cakes and cookies they can produce per hour. We can plot the number of cakes on the x-axis and the number of cookies on the y-axis, and then plot the combinations of cakes and cookies that they can produce per hour.

For Elif:

(0,80) (8,0)

For Burak:

(0,20) (10,0)

b) If each spends 30 minutes of each hour producing cakes and 30 minutes producing cookies, we can calculate their production using the following proportion:

For Elif:

Cakes = 8 cakes/hour * 30 minutes/60 minutes = 4 cakes

Cookies = 80 cookies/hour * 30 minutes/60 minutes = 40 cookies

For Burak:

Cakes = 10 cakes/hour * 30 minutes/60 minutes = 5 cakes

Cookies = 20 cookies/hour * 30 minutes/60 minutes = 10 cookies

c) The opportunity cost of producing cakes for Elif is the number of cookies that must be given up in order to produce one additional cake. Using the PPF, we can see that the opportunity cost of producing one cake for Elif is 10 cookies (80 cookies / 8 cakes).

The opportunity cost of producing cakes for Burak is the number of cookies that must be given up in order to produce one additional cake. Using the PPF, we can see that the opportunity cost of producing one cake for Burak is 2 cookies (20 cookies / 10 cakes).

d) The opportunity cost of producing cookies for Elif is the number of cakes that must be given up in order to produce one additional cookie. Using the PPF, we can see that the opportunity cost of producing one cookie for Elif is 0.125 cakes (8 cakes / 64 cookies).

The opportunity cost of producing cookies for Burak is the number of cakes that must be given up in order to produce one additional cookie. Using the PPF, we can see that the opportunity cost of producing one cookie for Burak is 0.5 cakes (10 cakes / 20 cookies)

e) Elif has a comparative advantage in producing cakes since her opportunity cost of producing cakes is lower than Burak’s. Burak has a comparative advantage in producing cookies since his opportunity cost of producing cookies is lower than Elif’s.

f) On the PPF lines, Elif will produce the most efficient combinations of cakes and cookies at the point where she reaches the highest level of production on the PPF. Similarly, Burak will produce the most efficient combinations at the point where he reaches the highest level of production on the PPF.

g) When Elif specializes in producing cakes and Burak specializes in producing cookies, they can trade their surplus products at a rate of 1 cake for x number of cookies. The number of cookies for 1 cake can be determined by their opportunity cost. So for Elif, the opportunity cost of 1 cake is 10 cookies and for Burak is 2 cookies. Therefore, Elif will be willing to trade 1 cake for at least 10 cookies, and Burak will be willing to trade 1 cake for at most 2 cookies.

What is meant by production possibility frontier?

The Production Possibilities Frontier (PPF) is a graph that shows all the different combinations of output of two goods that can be produced using available resources and technology. The PPF captures the concepts of scarcity, choice, and tradeoffs.

Learn more about PPF in brainly.com/question/17581360

#SPJ1

In 1956, Elvis made his first appearance in which of the following?

A. Recoding Studio
B. Live Concert
C. A movie
D. Church Meeting


I chose "C" a movie

Answers

Answer:

a movie

Explanation:

yeah you're right it's movie

Which tool helps an artist organize pieces of an image?
OA.
Selection
O B.
Shape
O c.
Layer
OD.
Hand

Answers

Answer:

c layer

Explanation:

yes

Layer

In digital art, you are able to draw components of the piece on different layers. This helps to organize and group elements of the art.

Name this sculpture, the time period it was created during, and its purpose

Answers

The Nike of Samothrace is the name of this sculpture. During the Hellenistic era, it was produced. It is assumed that it honored a significant naval victory or some kind of war triumph.

What do you mean by the  sculpture?

Sculpture is a type of art in which three-dimensional things are created out of hard or plastic materials. The designs could take the form of free-standing objects, reliefs on surfaces, or situations like tableaux or ones that enclose the viewer.

Sculpture from Ancient Greece and Ancient Rome, as well as the civilizations that were ruled or influenced by them, from roughly 500 BC to roughly 200 AD, are collectively referred to as classical.

Therefore, the Nike of Samothrace is the name of this sculpture. During the Hellenistic era, it was produced. It is assumed that it honored a significant naval victory or some kind of war triumph.

To know more about the sculpture, visit:

https://brainly.com/question/13522451

#SPJ1

what characteristic was least important to baroque comperes

Answers

Answer:

Stillness was least important to Baroque composers to create emotion because the Baroque period was all about deep emotion expression.  

Explanation:

This art is often created in order to make more than one copy. Once the image is created on the original medium, it can be reused multiple times.​

Answers

si no mal recuerdo, creo que si se podia

Answer: I am pretty sure it's Printmaking

help me pls will give brainly

Answers

Answer:

its 827, your welcome for that 1 minute

Explanation:

What is a given circumstance when it comes to your scene or monologue?

Pls put in your own words if you use gooogle

Answers

Question: What is a given circumstance when it comes to your scene or monologue?

Answer: In a dramatic scene or monologue or improvisation, the term “given circumstances” refers to the “who, where, what, when, why, and how”

Have a nice day

Answer:

In any type of scene ex: drama, of monologue and/or improvisation, the quote, given circumstances shows to including the words like who, where, what, when, why, and how so when you would use it in character like, what are you? Where are you? Who are you? Things like that.

Explanation:

Hope this helps :)

The roar of the dinosaurs in the Jurassic Park films include the sound from which of the following?
whale
O dolphin
anteater
O hummingbird

Answers

Answer:

dolphin

Explanation:

it was said they used a boy dolphin in heat's noises to get part of the effect they wanted.

Answer:

The answer is option 1, a whale.

Explanation:

Compare and contrast objective and nonobjective images. What is one thing that makes them different from each other?

A.
An objective image is a study in lines, colors, or other elements; a nonobjective image is based on a real object or scene.

B.
An objective image is a type of abstract art; a nonobjective image is not a type of abstract art.

C.
An objective image contains a familiar object that is easy to recognize; a nonobjective image contains a familiar object that has been distorted.

D.
An objective image contains a familiar object that has been distorted; a nonobjective image is not based on real objects.

Answers

Answer:

The answer is B

Explanation:

One thing that makes objective and nonobjective images different from each other is an objective image is a type of abstract art; a nonobjective image is not a type of abstract art. The correct option is B.

What are objective and nonobjective images?

Objective art is the one in which the subject is clear and this can be touched or seen by humans. They are opposite to abstract art. They have a proper meaning and sense.

Non-objective arts are the ones that have no sense. Artwork that is non-objective lacks discernible subject matter or recognizable forms. Nonobjective art focuses on the fundamental components of art rather than familiar things, people, or animals.

Therefore, the correct option is B. An objective image is a type of abstract art; a nonobjective image is not a type of abstract art.

To learn more about objective and nonobjective images, refer to the link:

https://brainly.com/question/14070940

#SPJ5

Other Questions
European exploration was motivated by a desire for economic profit. What natural resource did Europeans seek out in West Africa, South America, and a North America? How did they attempt to acquire this resource in each location? Math homework please help look at picture!! briefly describe the goals and scope of social work. she is drinking water change into negative Find the x and y Intercept of x + 2y = -14 What is human trafficking Which of the following statements best explains differences between the finches? A. Some finches were born with beaks that allowed them to have better access to different sources of food. These finches reproduced and passed on their genes.B. The beaks of the finches changed so all of the finches could eat the same types of food.C. The beaks of the finches changed as the species of finches migrated to the same island.D. The beaks of the finches changed as the finches' body sizes changed. The characteristics of type one diabetes Factor quadratic trinomials2x^2+7x+63x^2+5x+2With method X pleaseee:( How do you graph a parent graph? Do you agree with Wittgenstein that philosophy should focus on language? Why or why not? Cultural differences that might influence the guest service experience include all of the following except diet greetings humor marriage What was the Selective Service Act and how did it impact the war? When considering the various resources factors of production which of the following is most likely to represent capital? Find the area. The figure is not to scale You can NOT have an in group without having an out group True False 3 chairs and 4 tables cost rs 7540. if the price of a chair is 220 find the price of table?ans - 7120 two equivalent ratios for 17:5? Click on the edit DNA, you will now see the original sequence used to make the protein. ATGCCGGGCGGCGAGAGCTTGCTAATTGGCTTATAA The table below shows information about how many fans there were at twofootball matches in a local tournament.What is the difference between the number of away fans at the semi-final and atthe final?Semi-finalFinalTotal number of fans250400Ratio of home fansto away fans6:47:3