Select the correct answer.
The zeros of a quadratic function are 6 and -4. Which of these choices could be the function?
ОА,
f(x) = (x-6)(x-4)
OB.
fx) = (x-6)(x + 4)
fx) = (x + 6)(x + 4)
OD.
AX) = (x + 6)(x-4)
Algebra

Answers

Answer 1
You answer is the second one

Related Questions

PLLSSSS HEELP


Solve and graph this absolute value equation.

|x – 2| – 8 = 7

Answers

Step-by-step explanation:

y-8=7 y=15

|x-2|=15 has two solutions

17,-13

Answer:

answer

(x_2)- 8=7

2x=8-7

2x=1

that's the answer

Preview Activity 2.4.1. Consider the function f ( x ) = tan ( x ) , and remember that tan ( x ) = sin ( x ) cos ( x ) . What is the domain of f ? Use the quotient rule to show that one expression for f ′ ( x ) is f ′ ( x ) = cos ( x ) cos ( x ) + sin ( x ) sin ( x ) cos 2 ( x ) . What is the Fundamental Trigonometric Identity? How can this identity be used to find a simpler form for f ′ ( x ) ? Recall that sec ( x ) = 1 cos ( x ) . How can we express f ′ ( x ) in terms of the secant function? For what values of x is f ′ ( x ) defined? How does this set compare to the domain of f ?

Answers

Answer:

Step-by-step explanation:

Given the function f(x) = tan (x)

From trigonometry identity, tan (x) = sin(x)/cos(x)

f(x) = sin(x)/cos(x)

Using the quotient rule to find the derivative of the function, we will have;

f'(x) = cos (x)cos (x) - sin (x)[-sin (x)]/ cos²x

f'(x) = cos²x - sin²x/ cos²x

Divide through by cos²x

f'(x) = cos²x/cos²x + sin²x/cos²x / cos²x/cos²x

f'(x) = 1 + sin²x/cos²x / 1

f'(x) = 1 + (sin²x/cos²x)

f'(x) = 1 + tan²x

From trig identity,  1 + tan²x = sec²x

Hence, f'(x) = sec²x

Hence the expression  f'(x)  in terms of the secant function is sec²x

f'(x) = 1/cos²x

For the function to be defined, it means that cos²x ≠ 0

cos²x ≠ 0

cos x ≠ 0

x ≠ cos⁻¹0

x ≠ 90⁰

Hence the value of x must not be equal to 90 for the function to be defined. x can be defined at when x = 0 since cos 0 = 1, the equation will  becomes f'(0) = 1/cos²0 = 1/1 = 1.

Hence the function is defined at 0≤x<90

which is the product of 7/9 and 6 in a fraction number

Answers

Answer:

4 2/3

Step-by-step explanation:

7/9 multiplied by 6/1 = 42/9

Simplify: 14/3

Turn it into a mixed number: 4 2/3

Pls help me I will give out points

Answers

Answer:

A, the first one

Step-by-step explanation:

On the left side, the graph is going closer to 0, that explains the first coordinate 0. On the right side, the graph approaches positive infinity, so that explains the infinity. I hope this helps!

what is 1/11 divided by 4?(FRACTION FORM)

Answers

Answer: 1/44

Step-by-step explanation:

If BC = XY and XY = 8, then BC = 8
A Reflexive
B Transitive
Symmetric
none of the above

Answers

Answer:

Transitive

Step-by-step explanation:

It's like a train. Since bc is equal to xy and xy is 8.Then the value of xy equals to bc.

-3.5 , 2 , -3 , -1 , -1.5
Least to greatest

Answers

Answer:

-3.5, -3, -1.5, -1, 2

Step-by-step explanation:

Answer:

-3.5, -3, -1.5, -1, 2

Step-by-step explanation:

negatives to positives

A school janitor has my 1/3 of the classroom in five minutes at what rate is he mopping

Answers

Answer:

1/15 per min

Step-by-step explanation:

3 times 5 equals 15 and so 1/15.

Try making a visual picture to see yourself.

evaluate the​ expression, ​(g◦​f)(3​), given the following functions.
​f(x)=x+2 and ​g(x)=x

Answers

[tex]f(x) = x + 2\\g(x) = x\\(g \circ f) = g(f(x)) = x + 2\\g \circ f)(3) = 3 + 2 = 5[/tex]

Chloe bought three pounds of strawberries for $16.80. What is the price, in dollars per ounce of strawberries?

Answers

Answer:

$5.60

Step-by-step explanation:

Each pound of strawberries costs $5.60.

To solve: $16.80 divided by 3

Please I need help hurry!

Answers

Answer:

Step-by-step explanation:

Team B=2.2*4.8= 10.56

Team C : 10.56 *1.5=15.84

Determine the number of real or non real solutions of the equation listed below
using the discriminant.
x2 + x + 4 = 0

Answers

Answer:

x =(-1+√-15)/2=(-1+i√ 15 )/2= -0.5000+1.9365i

Step-by-step explanation:

I got two answers

What is qualitative data? Give an example.

Answers

Answer:

it is data that you can see or describe such as he is a boy

Step-by-step explanation:

1/2 + 2 3/4

Help please (◍•ᴗ•◍)❤​

Answers

Answer:

3 1/4

Step-by-step explanation:

Answer:

3 1/4

Step-by-step explanation:

im going to change the fractions to decimals

1/2 = 0.5

2 3/4 = 2.75

0.5 + 2.75 = 3.25

now im going to switch it back to fraction

3.25 = 3 1/4

How is the sentence "8 less than y is 2" written as an equation?
A. 8-y = 2
B. y - 2 - 8
C. y - 8 - 2
D. y + 8 - 2

Answers

Answer:

y - 8 = 2

thats how you would write it so idk i guess pick c because its the closest

"8 less than y" ==> y-8

"is 2" ==> =2

therefore y-8=2

Write 0.6 as a percentage.

Answers

Answer:

60%

Step-by-step explanation:

all you need to do is multiply this by 100 (move two decimal places to the right).

0.6--> 60

60 percent

Answer: 60%

Explanation: .6 x 100 = 60

How many squares are in the 11 squares

Answers

Answer:

11 Squares are there in 11 squares

Answer:

11

Step-by-step explanation:

because take your question and realize you put, "How many squares are in the 11 squares?"

(Sry if wrong or information misunderstood!)

How do you do this question?

Answers

Answer:

dy/dx = (2t + 3t²) / (2t)

Step-by-step explanation:

y = t² + t³

dy/dt = 2t + 3t²

x = 5 +t²

dx/dt = 2t

dy/dx = (dy/dt) / (dx/dt)

dy/dx = (2t + 3t²) / (2t)

6/10 as hundredths in fraction form and decimal form

Answers

Answer:

60/100 and .6

Step-by-step explanation:

The two triangles below are similar. Which pair are corresponding sides?

LN and MN
MN and QR
LM and QR
LM and PQ
hola estas ahi​

Answers

MN and QR

Hope it helps...

Find the distance between the points (-3, 5) and (7, -1), round the nearest 10th, if nessasary.

Answers

Answer:

The answer is 11.7 units

Step-by-step explanation:

The distance between two points can be found by using the formula

[tex]d = \sqrt{ ({x1 - x2})^{2} + ({y1 - y2})^{2} } \\[/tex]

where

(x1 , y1) and (x2 , y2) are the points

From the question the points are

(-3, 5) and (7, -1)

The distance between them is

[tex]d = \sqrt{ ({ - 3 - 7})^{2} + ({5 + 1})^{2} } \\ = \sqrt{( { - 10})^{2} + {6}^{2} } \\ = \sqrt{100 + 36} \: \: \: \: \: \: \: \\ = \sqrt{136} \\ = 2 \sqrt{34} \\ = 11.66190378...[/tex]

We have the final answer as

11.7 units to the nearest tenth

Hope this helps you

Hi can someone pls help me on the last question (#5)

Answers

[tex]solution \: (a) \:: [/tex]

[tex] \frac{1}{7} x = 1[/tex]

[tex]x = 7[/tex]

[tex] solution \: (b) \:: \\ x \times \frac{1}{11} = 1[/tex]

[tex]x = 11[/tex]

[tex]solution \: (c) \:: [/tex]

[tex]1 \div \frac{1}{5} = x[/tex]

[tex]x = 5[/tex]

Math 7 A Unit 4 lesson 2 Please help quick
5/10-3/10
1/2+3/4
1/6+3/8
7/8-5/12

Answers

Answer:

2/10, 1 1/4, 13/24, 11/24

Step-by-step explanation:

1. subtract the fractions

2. add the fractions

3. add the fractions

4. add the fractions

PLEASE HELP ASAP What part of 6 3/5 is 3 /10 ? PLS HELP ASAP

Answers

Answer:

the 3/5 part of 6 3/5

Step-by-step explanation:

3/5 is equal to 3/10 because when you find the common denominator of 10, you multiply 3/5 by 2 and 3/10 by 1 because 10 is already 10. 3/5*2=6/10.

What transformation occurs to the graph f (x) =2x + 3 if the 3 in the equation is changed to a 5?

Answers

The equation will shift up two points

-6(1/4x-2/3x+5/6x) simplified .

Answers

Answer:

[tex]-2\frac{-1}{2}[/tex]

Step-by-step explanation:

To distribute the -6, multiply every numerator by -6, this gets you

-6/4+12/3-30/6

To put these together, they all need to have a common denominator. We can make all of the denomiators 12 by multiplying the numerator by whatever we multiply the denominators by to get 12.

-18/12+48/12-60/12

This gets you -30/12

To make this a proper fraction, divide -30 by 12 and put the whole number to the left of the fraction (-2), making a mixed number. The remainder stays a fraction which is -6/12. This reduces down to -1/2. Put -2 and -1/2 together to get [tex]-2\frac{-1}{2}[/tex]

Please help me answer this :)?

Answers

Can you add an image please?

45 2/3 + 30 1/2 + 12 3/4=?​

Answers

88.9166666667.................

A submarine dives 20 meters each minute for 15 minutes. What is the total change in depth after 15 minutes?

Answers

The correct answer is 300 meters

Answer:

300m

Step-by-step explanation:

20 Times 15=300

An account grows at an annual interest rate of r⁡​ ⁣, so it grows by a factor of x=1+r⁡​ ⁣⁣ ​⁡ each year. The function A(x)=800x 4 +350x 3 +500x 2 +600x⁣ ​⁡ gives the amount in the account after 4 years when the growth factor is x⁡​ ⁣⁣ ​⁡. What is the total amount in the account if the interest rate for the account is 3% each year? How much money was put into the account at the beginning?

Answers

Given:

Annual interest rate = r⁡​%

Growth factor : x = 1 + r⁡​

The below function gives the amount in the account after 4 years when the growth factor is x⁡​ ⁣⁣.

[tex]A(x)=800x^4+350x^3+500x^2+600x[/tex]

To find:

The total amount in the account if the interest rate for the account is 3% each year and initial amount.

Solution:

Rate of interest = 3% = 0.03

Growth factor : x = 1 + ⁡0.03 = 1.03

We have,

[tex]A(x)=800x^4+350x^3+500x^2+600x[/tex]

Substitute x=1.03 in the given function, to find the total amount in the account if the interest rate for the account is 3% each year.

[tex]A(1.03)=800(1.03)^4+350(1.03)^3+500(1.03)^2+600(1.03)[/tex]

[tex]A(1.03)=800(1.12550881)+350(1.092727)+500(1.0609 )+618[/tex]

[tex]A(1.03)=900.407048+382.45445+530.45+618[/tex]

[tex]A(1.03)=2431.311498 [/tex]

[tex]A(1.03)\approx 2431.31 [/tex]

Therefore, the total amount in the account is 2431.31 if the interest rate for the account is 3% each year.

For initial amount the rate of interest is 0.

Growth factor : x = 1 + ⁡0 = 1

Substitute x=0 in the given function to find the initial amount.

[tex]A(1)=800(1)^4+350(1)^3+500(1)^2+600(1)[/tex]

[tex]A(1)=800+350+500+600[/tex]

[tex]A(1)=2250[/tex]

Therefore, 2250 was put into the account at the beginning.

Other Questions
if a doctor states that a patient has a bone break in the left anterior portion of their body, lateral to midline in their thoracic cavity, what can you assume im broken? In the gene TATTCATTGTTATGATTTATTCG, CATTGTTA encodes for pepsin, a digestive enzyme. The rest of the sequence doesnt code for any protein. Which sequence contains a mutation that will affect the formation of pepsin?A. TATTCATTCATTATGATTTATTCGB. TATTCATTGTTATGACTTTATTCGC. TATTCATTGTTATGATTTATTGGCGD. TATTCATTGTTATGATATTCGE. TGCATTCATTGTTATGATTTATTCG Which changes resulted from industrialization in the United States in the late 19th and early 20th centuries?A) increased number of people living in urban areasB) less crowded citiesC) more efficient farm production as machines replaced human laborD) decreased immigration from other countriesE) shift from a predominance of agricultural workers to a predominance of factory workers PLEASE HELP ME ANSWER AS MUCH AS YOU CAN I ONLY HAVE 3 POINTS LEFT AND IM TIMED. PLEASE TELL ME THE NUMBER AND LETTER. THANK YOU!!!!!!!!!!!1. Read the excerpt from a students report.I was honored to be a part of an online group of students from the United States, Africa, and China seeking solutions to water shortages. While we all had great enthusiasm about changing the world, the project quickly dissolved because no one was willing to listen to differing viewpoints.Which line could be added to show the difference a digital leader can make? A. We agreed as a group to spend some time studying each others country and meet again at a later date. B. We saved the project by allowing each group to share their thoughts and then chose the best solutions.C. We decided to disband and seek solutions with students from other countries who shared our viewpoints. D. We thought it would be best to stop meeting until our cultural differences can be addressed._______________________________________________________2. Electronic medical charts make it easier for doctors to A. share information on patients with other doctors. B. share information on patients with the government.C. communicate with patients about medical issues.D. track infectious diseases through a database.______________________________________________________3. Which is the best example of collaboration in a digital environment?A. Students meet in-person at a local library.B. Students work together on a project from a distance.C. Students work independently on a project from a distance. D. Students meet in a classroom to research a project._______________________________________________________4. In addition to talking to other doctors remotely, telehealth technologyA. allows patients and doctors to talk online.B. gives doctors the ability to keep people healthier.C. eliminates the need for doctors to see patients. D. allows patients to self-diagnose using the Internet. Exchanging goods or services of equal value is called (blank)(blank) replaces the need for bartering.Money allows us to exchange (blank) for goods and services. 275,000 plus 5.4 times 10 to the 5th power Whats a religion ??? Javier has a basket of oranges and apples. The number of oranges is 2 more than twice the number of apples in the basket. The difference of half the number of oranges and half the number of apples is 4.An equation created to find the number of apples Javier has in the basket will have What are all the correct equations factorizar por el motodo de aspas [tex]12x^2 = 3x + 2[/tex] Consider this expression. -3x2- 24x - 36 What expression is equivalent to the given expression? Read the poem. Then, select the correct answerexcerpt adapted fromI Wandered Lonely as a Cloudby William WordsworthI wandered lonely as a cloudThat floats on high o'er vales and hills,When all at once I saw a crowd,A host, of golden daffodils;Beside the lake, beneath the trees,Fluttering and dancing in the breeze,Continuous as the stars that shineAnd twinkle on the milky way.They stretched in never-ending lineAlong the margin of a bayTen thousand sawl at a glance,Tossing their heads in sprightly dance.For oft, when on my couch I lieIn vacant or in pensive moodThey upon that inward eyeWhich is the bliss of solitude:And then my heart with pleasure fills,And dances with the daffodils.Which word best describes the author's tone?Aadmiring.desperateOC somberOD playful \How does the allusion to Ham affect the meaning of the text?It emphasizes Douglass's desire to be free.It allows Douglass to discredit using the Bible to justify slavery.It highlights the similarities between enslaved people and those who enslave them.It compares slavery in the modern world to slavery in Biblical times. Write the definition of a function named count that reads all the strings remaining to be read in standard input and returns their count (that is, how many there are) So if the input was: hooligan sausage economy ruin palatialthe function would return 5 because there are 5 strings there. PLSS HELPP What is the value of x in this equation?4x 2(2x 2) = 2(2x 4) The company's profit will be exactly $0 if it makes and sells jackets. The company will make a profit if it makes and sells jackets, but will not make a profit if it makes and sells jackets why are Hispanics not a race in the u.s but only defined as ethnicity? Leann is learning about chemical reactions. She wants to create a model of a chemical reaction, so she is examining the information that she should include. What are the different components that she should include in her model? Choose the three that apply.A.the kinds of atoms that form during a reactionB.the kinds of molecules involved in the reactionC.the kinds of elements that make up a moleculeD.whether the molecules are products or reactantsE.whether the products have more mass than the reactants which part of the government according to the constitution, should be made up to two representatives per state? (Apex) A. the senate B. congress C. the Articles of confederation D. the House of representatives (4x5)+6x4+(9-3) (5+6) show your work