Please help meeee!!!


Study the dashed arrows in the image.


What causes the arrows to move in this direction?

Earth rotating
air moving to the poles
Earth’s equator
wind moving over short distances

Please Help Meeee!!!Study The Dashed Arrows In The Image. What Causes The Arrows To Move In This Direction?Earth

Answers

Answer 1
The earth is rotating on its axis
Answer 2

Answer:

Earth rotating (option A)

Explanation:

i got 100% on my quiz for EDGE


Related Questions

Which of the following correctly identifies the function of the cell membrane?
A
controls what enters and leaves the cell
B
produces protein and enzymes
C С
controls the cell function
D
stores genetic infromation for the cell

Answers

Answer:

a controls what enters and leaves the cell

Explanation:

help please n thx <3

Answers

Answer:

The answer is The cell that contains the nucleus.

Question 6 of 20
A girl swings a yo-yo around in circles. How can she increase the total energy
of this system?
O
A. Reverse the direction of the swing,
O
B. Stand on a table while swinging the yo-yo.
C. Sit on the ground while swinging the yo-yo.
о
D. Swing the yo-yo at a lower speed,
SUBMIT

Answers

Answer:

it's B

Explanation:

A girl can increase the total energy of this system by standing on a table while swinging the yo-yo. Thus, the correct option is B.

What is Yo-yo?

Yo-yo may be defined as a type of toy that consists of a pair of joined discs with a deep furrow between them in which thread is attached and wound.

By reversing the direction of the swing, swinging the yo-yo at a lower speed, and sitting on the ground while swinging the yo-yo decrease the total energy of the system. This is because the system does not have the momentum that is required to increase its overall energy.

Therefore, a girl can increase the total energy of this system by standing on a table while swinging the yo-yo. Thus, the correct option is B.

To learn more about Total energy of the system, refer to the link:

https://brainly.com/question/478253

#SPJ5

What is the use of tail in human sperm?​

Answers

It’s an adaptation that allows the sperm to travel to the egg more efficiently as the distance is long and most sperm do not make it to the egg so this increases the chance of fertilisation.

Explanation:

At what temperatures can monarch fly?

Answers

Answer:55 degrees

Explanation:In order for an adult monarch to fly, temperatures need to be above 55 degrees Fahrenheit.

Answer:

Temperatures need to be above 55 degrees Fahrenheit.

Explanation:

Choose one carbon sink and explain how the carbon gets out of it.

Answers

Answer::

Explanation:

The process during which a preexisting cell splits to form two cells is called

Answers

Mitosis is the process of a pre existing cells dividing into two cells.

This is the science of correct reasoning. The basic components are statements that can be true or false, but never both.​

Answers

Answer:

The basic components are statements that can be true or false, but never both. Magnetic Resonance Imaging This is a non-invasive body imaging procedure that uses powerful magnets and radio waves to construct pictures of the internal structures of the body.

Explanation:

what is carrying capacity? what type of population growth does it affect?

Answers

Carrying capacity is referred to a population size of species in a particular habitat. In an ecosystem, the population of a species will increase till it reaches its carrying capacity. Then the population size remains relatively equal.

What are the types of carrying capacity?

Carrying capacity is the maximum limit till that the ecosystem can support the existence of the population.

There are four categories of carrying capacity, namely:

Physical.Ecological.Economic.Social.

A specific environment's carrying capacity is the maximum population size that it can support.

The carrying capacity modifies the growth rate by slowing it when resources become scarce and stopping growth once it is reached.

Thus, it can be concluded that the carrying capacity is the average population size of species in a particular habitat which slows and stops the growth rate on reaching it.

For more details regarding carrying capacity, visit:

https://brainly.com/question/2375972

#SPJ1

if a person has a dominant gene and a recessive gene for a certain trait which will be expressed

Answers

Answer:

The dominant gene will be expressed

Explanation:

Recessive genes are only expressed when you have two recessive genes and no dominant.

What are the differences between the Big Bang Theory and the Steady State Theory?

Answers

Answer

One is a move and the other is a part of a state.

Explanation:

Answer:

The only difference, he explained, was that in the big bang scenario all the matter was created in one explosive beginning.

Where is the error in the diagram?



DNA is copied during the shortest stage.


The cytoplasm divides during the longest stage.

The nucleus divides in the stage before the cytoplasm divides.

Both the nucleus and the cytoplasm divide in the same stage.

Answers

Answer:

But where is your diagram

Answer:

C

Explanation:

Which element is able to combine in many ways with different elements and is therefore considered the basis of life?

Answers

Answer:

Carbon

Explanation:

Carbon is the answer

2. Describe a situation in which unbalanced forces are acting on an object. What is the net force
on the object, and how does the net force change the motion of the object?

Answers

Answer:

The force is by putting the two same objects on both sides and the motion is the scale

The force is by putting the two same objects on both sides and the motion is the scale.

What do you mean by force?

In physics, a force is an influence that can change the motion of an object. A force can cause an object with mass to change its velocity, i.e., to accelerate. Force can also be described intuitively as a push or a pull.

The normal force acts in a direction normal to the surface interaction between objects. Friction is a force that opposes motion on surfaces. Other examples of non-fundamental forces include the elastic force, tension.

Force is the fundamental result of an interaction between two objects, while power is an expression of energy consumed over time (work), of which force is an element.

Learn more about force:

https://brainly.com/question/13191643

#SPJ2

how might toxicology be important to other biomedical professions outside of forensics?

Answers

Answer: See explanation

Explanation:

Toxicology is a field in science that has to do with the effects of poisons, toxics and how they can be treated. Through toxicology, one can understand how harms are caused by chemicals and the health of the public can be protected.

Toxicologists study chemicals, drugs and other substances, and looks at how safe they're and their impact on living organisms. Toxicologists help in the development of methods that'll be used to know the harmful effects and the the dosages which causes it.

Furthermore, toxicology gives vital information and knowledge which the decision makers or regulatory agencies

in other biomedical fields can use in order to put programs in place that can be used to limit the exposures of humans to the substances.

In conclusion, less exposure to these substances is vital so that diseases can be prevented.

Toxicology is also used in the field of environmental health.

Toxicology will be important to other biomedical professions outside of forensics. Toxicology can be used in environmental health field which provides critical information and knowledge about the toxic substances that can be used by regulatory agencies to limit our exposures to toxic substances so we can say that toxicology plays an important role for other biomedical professions.

Learn more: https://brainly.com/question/18122705

what is human intercose

practical of human intercose​

Answers

Answer:

Sexual intercourse, also called coitus or copulation, reproductive act in which the male reproductive organ (in humans and other higher animals)

What’s the answer ????????

Answers

it’s d
i looked it up and it’s the exact same:)

Answer:

D: Electrons are transferred from one atom to another.

Explanation:

Protons are not involved in the covalency, and C, electrons are shared between two atoms, is the definition of a covalent bond, such as water. Ionic bonds form when two atoms, share (transfer) electrons to one another in order to fill the outer electron ring.

Hope this helps!

*MAY* give brainliest!

Please give answer and explain:

This sequence encodes for a particular protein that helps bacteria move. A mutation occurs in the sequence, leading to a faulty protein. Identify the sequences where the mutation might have taken place.

ATTTGCATACTACCGGGC

The letters in bold with a yellow highlight are the noncoding region, and the other letters are the protein coding region.

Group of answer choices

ATTTGCAATACTACCGGGC

ATGAATGCATACTACCGGGC

ATTTGCATACTGACCGGGC

ATTTGCAACTACCGGGC

ATTAGCATACTACGGGC


Highlighted letters are: ATACTACC

Answers

Answer:

1 and 5

Explanation:

https://brainly.com/question/11362587?utm_source=android&utm_medium=share&utm_campaign=question

Answer:

1.ATTAGC(ATACTAC)GGGC

5. ATGAATGC(ATACTACC)GGGC

Which factor is different between the tundra biome and a tundra ecosystem?
A. Soil moisture
B. Climate
C. Size
D. Type of plants

Answers

Answer:

b it is the climate

Explanation:

B the climate

Answer  C.Size

Explanation:

the reason why it is not climate is because the climate is the same. So as the soil moisture. The tundra biome is a bigger size than the ecosystem. The order from largest to smallest level of organism: biosphere,biome,ecosystem,community, population, and last organism.

Which of the following is an example of a complex machine?
1. Pulley
2. Wedge
3. Scissors
4. Incline

Answers

3- Scissors are an example of a complex machine.

Answer:

A :3

Explanation:

Just did acceleratted ed. Hope this helps!

What is a carbon producer

Answers

Answer:

There are many many things in the world that produces Carbon. The largest source of greenhouse gas emissions from human activities in the United States is from burning fossil fuels for electricity, heat, and transportation. All of these produce Carbon into the atmosphere and warm the planet

2. What is the name of the process of gathering evidence called? *
1 point
the Experimental Process
the Scientific Proof
the Scientific Experiment
the Scientific Method

Answers

Answer:

the answer is d scientific method

Answer:d the scientific method

Explanation:

What does “denature” mean in terms of protein structure?

Answers

Explanation:

Denaturation, in biology, process modifying the molecular structure of a protein. Denaturation involves the breaking of many of the weak linkages, or bonds (e.g., hydrogen bonds), within a protein molecule that are responsible for the highly ordered structure of the protein in its natural (native) state.

Which of the following events occurs the earliest during the process of photosynthesis?

Answers

Answer:

If you give me the choices to choose from I cna answer.

Explanation:

Which of the following is a term use to describe a mound, hill of ridge of wind-blown sand?
A.peak
B.hill
C.contour
D.dune​

Answers

The answer is D.dune

PLEASE HELP ME I DONT KNOW THE ANSWER!!!!!

Answers

Answer: I think the answer is ( d) because the two tails are together to get stuck in the membrane as the picture shows

Explanation:

NEED ASAP


Which quality would make the question "What will make cows produce more milk?" a good scientific question for a
biologist to investigate?
A) It is about living things and is testable.
B) It will help consumers save money.
C) It will lead to new technology to gather milk.
D) It is a question that can have many answers.

Answers

Answer:

D

Explanation:

The scientist could find new tech, which could lead to lower prices, also, it is about living things and testable, so it would be many answers.

which of the following statements are true?
A. Flavr Savr tomatoes are still commercially successful.
B. A large percentage of US crops are currently genetically engineered.
C. Glyphosate kills all plant life, even genetically altered plants.
D. None of these are true

Answers

B! we had to alter them to our preferred taste and nutrients

Which accurately labels the cytoplasm?
w
Х
Y
Z

Answers

Answer:

Y is the answer

Explanation:

I am 100%sure that the answer is Y

Explain the law's of segregation and independent assortment.

Answers

Answer:

The law of segregation states that the two alleles of a single trait will separate randomly, meaning that there is a 50% either allele will end up in either gamete. This has to do with 1 gene. The law of independent assortment states that the allele of one gene separates independently of an allele of another gene.

Explanation:

I know it late but can u plz mark me brainliest?

Other Questions
Which two spheres are interacting when there is a rainbow ? Please help make you brainiest. On Monday, Sarah has to meet her friend at the park after school The distance from her house to school is 2x+5 The distance from the school to the park is z If the total distance she was that day is 10x +9 how far is it from the park back to herhouse? plz help i mark as brainlest! In what type of economy does the government try to control all factors of production Can u answer part A and C "Explain why fish, specifically steelhead trout, would be an effective indicator species" Why was the Marquis de Lafayette called the Hero of Two Worlds?A.He helped both Mexico and the United States achieve independence.B.He participated in both the American and French revolutions.C.He helped both Canada and the United States achieve independence.D.He participated in both the American and Haitian revolutions. What does the excerpt reveal about the historical context of the story?O: Cars were more popular than trains.O: Traveling by train was common.O: Judicial districts covered large areas.O: There were laws preventing animal cruelty. What is the answer to 2 subtract 2? Monarchs benefited from the Crusades because they were able to take power of ________ A popular and useful tool for strategic planning is SWOT analysis. SWOT stands for In Crestview Middle School, 12 out of 16 students are right handed. If there are 400 students in the school, how many are right handed? This program will calculate the rise in ocean levels over 5, 10, and 50 years, Part of the program has been written for you. The part that has been written will read in a rise in ocean levels (per year) in millimeters. This value is read into a variable of type double named risingLevel. You will be completing the program as follows Output the value in risingLevel. This should be the first line of output. The output should be as follows (assume risingLevel has a value of 2.1) Level: 2.1 The number of millimeters higher than the current level that the ocean's level will be in 5 years (assuming the ocean is rising at the rate of risingLevel per year). This is your second line of output. The output will be as follows Years: 5, Rise: 10.5 The number of millimeters higher than the current level that the ocean's level will be in 10 years (assuming the ocean is rising at the rate of risingLevel per year). This is your third line of output. The output will be as follows (for a risingLevel" of 2.1 Years: 10, Rise: 21 The number of millimeters higher than the current level that the ocean's level will be in 50 years (assuming the ocean is rising at the rate of risingLevel per year). This is your final line of output.The output will be as follows (for a risingLevel" of 2.1) Years: 50, Rise: 105 For each of the above you need to output the number of years and the total rise in ocean levels for those years. This is all based on the value in risingLevel For example: ArisingLevel of 2.1 for 5 years would have the following output: Level: 2.1 Years: 5, Rise: 10.5 Years: Years: 50, Rise: 105 10, Rise: 21 Your output must have the same syntax and spacing as above Patrick did an experiment to study the solubility of two substances. He poured 100 mL of water at 20 C into each of two beakers labeled A and B. He put 60 g of Substance A in the beaker labeled A and 60 g of Substance B in the beaker labeled B. The solution in both beakers was stirred for 1 minute. The amount of substance left undissolved in the beakers was weighed. The experiment was repeated for different temperatures of water and the observations were recorded as shown.Experimental ObservationsSubstance Mass of Undissolved Substance at Different Temperatures (gram) 20 40 60 80 A 18 14 10 5B 60 60 60 60Part 1: Which, if any, substance is soluble in water?Part 2: Explain how the data helped you determine solubility for both substances for temperatures 20 C to 80 C. 12Paul Simmons earns $47,500 as an office manager. If his company issuesweekly paychecks, how much is each check?* HELP PLEASE !!!What is the vertex of this parabola?y-5 = x^2? Which lists all the multiples of 8 that are less than 50?A. 2, 4, 8B. 4, 8, 12, 16, 24, 32, 40, 48C. 8, 16, 24, 32, 40, 48D. 8, 16, 24, 32, 40, 48, 56 Hey guys i dont know who to vote for plz give me suggestions and reasons why Was mercantilism good or bad for Native Americans Why? Which of the following is an organ shared by the respiratory system and the digestive system? larynxpharynxtracheaesophagus