(No linksssssssssssss)

Pls help me~English ~I’ll mark brainliest if correct <3

(No Linksssssssssssss)Pls Help Me~English ~Ill Mark Brainliest If Correct &lt;3

Answers

Answer 1
I’m 95% sure it’s B.

Related Questions

After looking at the picture provided, write a story (in a 20 minute time limit) about what you think is going on in the picture. It is a creative writing, do not write what is actually going on in the picture if you know.

Answers

Answer:

I think its a natural disaster, you can see people gathering around and theres a big crowd of people. And you can somewhat see some smoke, and cars are everywhere. So I think something happened, and its like a natural disaster.

Hope this helps, rewrite it in your own words!

The evidence presented here supports the authors claim that fast food restaurants are like factories because the excerpt

Answers

Answer:

illustrates the assembly line principle of making things faster.

Explanation:

The assembly line principle illustrates the process in which the production is managed and the way it helps in the completion of the product. In this process the manufacturing process is broke up into simpler steps. The labor involved in the manufacturing of the product is divided.  

In the given excerpt, fast food restaurants like Burger King, Pizza Hut and Mc Donald's presented their products like the factories. They adopt the method the assembly line for the purpose.

‘’Only today I wish I didn’t have only eleven years rattling inside me like
pennies in a tin Band-Aid box.''
what is happening in the quote. Who is talking? What is happening?

Answers

Answer:

The pennies represent the emotions that are rattling inside of Rachel. They can represent more than one maturity or age level in a moment. This reflects her anxious tone. Her emotions are bouncing within her as loudly as pennies in a tin can.

Explanation:

why did BRIAN described the moose attack as " insane" in the book called HATCHET​

Answers

Answer:

Brian finds the moose attack to be "insane" and "madness." He seeks rationality in the act, and attempts to make sense of the moose's motives.

“That’s one small step for man, one giant leap for mankind.”
– Neil Armstrong
juxtaposition
Explain your answer why it is juxtaposition

Answers

Answer:

Contrasting the steps for man and a leap for mankind

Enter the correct 4 digit code (no spaces) *

Answers

Answer:

1. D

2. C

3. B

4. A

One meaning of insolent is "insulting, rude or contemptuous."

Based on this definition, what is the most likely definition of insolence?


full of respect

being disrespectful

apologizing for being rude

having a civil attitude

Answers

Answer:

The answer is B, being disrespectful

Explanation:

I took the quiz

Based on the given definition of insolent as "insulting, rude, or contemptuous," the most likely definition of insolence would be being disrespectful, hence option B is correct.

The term "insolence" describes actions or words that are disrespectful, rude, or demeaning to other people. It entails demonstrating a lack of respect for authority, a disrespect for social norms, or a disregard for expectations.

Condescending, haughty, or disrespectful language or actions towards other people are examples of insolent behaviour. It frequently entails a spirit of defiance, a disdain for the consequences, or a purposeful effort to arouse or annoy.

Insolence can arise in a variety of social circumstances, including private conversations, formal settings, and public discourse.

Learn more about condescending here:

brainly.com/question/13946208

#SPJ6

Can someone help me define Usher Sydrome in you’re OWN WORDS pleaseeee

Answers

Answer:

I would say that Usher Syndrome is an uncommon disorder that is characterized by partial or even total hearing loss and vision loss that worsens over time.

What is tone in writing?

Answers

It’s a simple question, but the answer can be rather complicated. In this post, we’ll break down the 9 different types of tones in writing.

In basic terms, tone usually refers to how a writer uses certain words in a specific way to convey non-verbal observations about specific subjects. Not only does tone help to deliver facts, but it delivers them with an attitude. With emotion. With a personal perspective.

1. Joyful

This tone in writing focuses on the positive emotions that are experienced in the moment of an action. If you eat something you like, then you feel joy. When you experience reciprocal love, you feel joy.

Writers use this tone to create relationship-building experiences between their readers and their characters.

2. Serious

This tone in writing creates a level of suspense within the reader. With this tone, the writer conveys the message that the concepts in the text are important. This, in turn, increases the reader’s focus.

3. Humorous

Being funny does more than make people laugh. It also makes them begin to think about difficult concepts in a way that feels safe.

This tone in writing is often intended to draw the reader into a story or narrative so they can engage with certain facts or opinions the author feels are important to share.

4. Sad

Sadness is a very real part of the human condition. In many ways, our saddest days define who we are as people. When incorporated as a tone in writing, the reader becomes sympathetic with the characters or the author. This empathy will keep them engaged with the narrative.

5. Formal

This tone in writing is often seen from an academic standpoint. It requires structured language, higher reading skills, and presents more facts that can be proven than the opinions of the writer.

6. Informal

The goal of this content is to have an informal tone. It’s conversational, but still conveys a certain sense of expertise within the subject material.

7. Optimistic

There’s a lot of bad stuff going on in the world today. Yet there is also a belief that the world can and will be a better place one day if we’re willing to work for it. This would be an example of an optimistic tone.

8. Pessimistic

When there’s a lot of bad stuff going on in the world, it can feel like that bad stuff will only get worse. That kind of tone would be an example of being pessimistic. Pessimism is not realism. Being pessimistic means having a belief that something will never get better, even if the facts may seem to indicate otherwise.

9. Horror

This tone of voice is threatening in nature. It speaks to the core fears that people have and forces them to confront those fears.

Answer:

Tone is a way for authors to express their thoughts and emotions through writing.

please help
Critique your use of narrative writing strategies and figurative language in your own narrative writing in this module.

Answers

Answer:

So um what is the question???

Explanation:

Why it matters that teens are reading less

Answers

Answer:

It matters that teens are reading less is because they need education to get a job and if they don't have education they can't get a good enough job to pay their bills and live in a house that is why some young people are living in the streets because they didn't ahve good enough jobs so they can pay their bills on time.

Explanation:

example of connotation​

Answers

Answer: an idea or feeling that a word invokes in addition to its literal or primary meaning.

"the word “discipline” has unhappy connotations of punishment and repression"

Explanation:

can somebody help me find hoping please!!!!!!!!!!

Answers

Answer:

i circled it

Explanation:

Who here has spotify?

Answers

meeee follow me at kayllgros44

Answer:me

Explanation:

Uzupełnij pytania I napisz krótkie odpowiedzi.


1……………..your schoolbag made of denim? No, ……………………..


3…………………………………this portrait painted in 1926? Yes,…………..


4…………………………the sculptures washed every year? No,………………


5…………………………….those sculptures made by Picasso in the past? Yes,………


6………………….the Colosseum located in Rome? Yes,………………

Answers

Answer:

1. Is your schoolbag made of denim? No, it isn't.  

3. Was this portrait painted in 1926? Yes, it was.  

4. Are the sculptures washed every year? No, they aren't.  

5. Were those sculptures made by Picasso in the past? Yes, they were.  

6. Is the Colosseum located in Rome? Yes, it is.

Explanation:

The activity above concerns the use of the verb "to be" in the simple present and the simple past tenses.

In the present tense, the verb "to be" has three forms: am, is, and are. "Am" is used with "I", "is" is used with "he, she, it", and "are" is used with "you, we, and they". We use this tense in numbers 1, 4, and 6 above because those are questions about the present moment.

In the past tense, the verb "to be" has two forms: was and were. "Was" is used with "I, he, she, and it", and "were" is used with "you, we, and they". We use this tense in numbers 3 and 5 above because those are questions about the past ("1926", and "in the past" are our clues".

what is 5x5 5x5x5x55

Answers

Answer:

171875

Explanation:

PLSSS HELPPPP I WILLL GIVE YOU BRAINLIEST!!!!!! PLSSS HELPPPP I WILLL GIVE YOU BRAINLIEST!!!!!! PLSSS HELPPPP I WILLL GIVE YOU BRAINLIEST!!!!!! PLSSS HELPPPP I WILLL GIVE YOU BRAINLIEST!!!!!!PLSSS HELPPPP I WILLL GIVE YOU BRAINLIEST!!!!!! PLSSS HELPPPP I WILLL GIVE YOU BRAINLIEST!!!!!! PLSSS HELPPPP I WILLL GIVE YOU BRAINLIEST!!!!

Ecological Relationships

Answers

Answer:

The interaction among organisms within or between overlapping niches can be characterized into five types of relationships: competition, predation, commensalism, mutualism and parasitism. ... Symbiosis refers to a close relationship in which one or both organisms obtain a benefit.

Explanation:

hope this helps and give me brainliest if u want :)

Select the correct text in the passage.
Which two lines in this excerpt from "Song of Myself" by Walt Whitman reflect a realist view of death?
I bequeath myself to the dirt to grow from the grass I love,
If you want me again look for me under your boot-soles.
You will hardly know who I am or what I mean,
But I shall be good health to you nevertheless,
And filter and fibre your blood.
Reset
Reset
Next

Answers

1&3 1 I would say because when you die and get buried grass will grow on top of your grave like it says dirt to grow from the grass I love and 3 is saying you don’t know who he is and what he mean so that’s a reason to die he doesn’t know anyone or anyone doesn’t know him

Which is the closest antonym for the word obstacle?

A emergency
B advantage
C compliment
D hurdle

Answers

Answer:

B advantage

Explanation:

Hope it helps you in your learning process.

Why is it important for people to have the opportunity to define their own cultural identity as opposed to allowing themselves to be labeled by others as belonging to one group or another?

Answers

Answer:

Because it is important that the individual identifies himself with the cultural concepts with which he feels comfortable and happy.

Explanation:

Cultural identity is a very important characteristic for the construction of an individual's personality, in addition to helping in the composition of behavior and in the feeling of belonging and comfort. This is because cultural identity is what allows a person to identify himself/herself as a member of a people. Once the individual is able to determine his/her cultural identity, it is possible that he or she will be able to assume cultural concepts and customs with this people. Cultural identity is highly malleable, but it is important that it is built based on the individual's own thoughts, preferences and concepts, as only the individual will be able to build an identification.

Please help and NO LINKS I WILL REPORT YOU IF ITS A LINK

Which sentence contains gender-neutral language?

A.) The firemen loaded their equipment and started up the ladder.
B.) The stewardess helped load passengers onto the plane.
C.) A company is looking to replace the chairman of the board.
D.) Recycling helps preserve the Earth for all humankind.

Answers

D, it's the only one that doesn't specifically use a gendered word (firemen, stewardess, chairman)

The answer is D :)) good luck

Read the following paragraph from the section "Mirrors can change smells." There is much more to learn and discover about the biology and chemistry of taste and smell. Those of us who study the chemical senses hope that our research will lead to tastier and healthier food, reduce the spread of insect-borne disease, improve the lives of people with smell or taste disorders and create a better understanding of the importance of smell and taste. Why does the author include this paragraph in the article?

Answers

Answer:

Hii, so the answer is, to show plans for the future of research and studying senses.

Hope this helps!

sorry if I'm too late ;w;

What text structure is used in this passage?

Edith was born the oldest of five children. When she was three, her family moved to London. At age eight, she was sent to school, where she discovered her talent for art. By the time she was twelve, she had sold several paintings. At fifteen, she held her first art exhibition.

A. chronological order

B. cause and effect

C. comparison-contrast

D. problem-solution

Please help no files though

Answers

Answer:

Comparison-Contrast

Explanation:

Answer:

A. chronological order

Explanation:

Lines 67–75: What examples of hyperbole are in these lines? Describe their overall effect. Dwelling

Answers

Answer:

7.05

Explanation:

because if you subtract and add the number so we say answer is 7.05

Lines 67–75 of the poem "The Raven" by Edgar Allan Poe contain examples of hyperbole, which is a figure of speech that involves exaggeration for emphasis or effect.

What is hyperbole?

The hyperbole in these lines lies in the description of the raven, whose presence is depicted as exaggeratedly eerie and unsettling. For example, the raven is said to "never flit," implying that it is stationary and unmoving, which is an exaggeration since all birds must move at some point. Additionally, the raven's eyes are described as having "all the seeming of a demon's that is dreaming," which is another exaggeration that portrays the bird as malevolent and supernatural. The overall effect of these hyperboles is to intensify the mood of the poem and create a sense of horror and unease.

Hence, lines 67–75 of the poem "The Raven" by Edgar Allan Poe contain examples of hyperbole, which is a figure of speech that involves exaggeration for emphasis or effect.

Learn more about the hyperbole here.

https://brainly.com/question/30957396

#SPJ2

complete question is below

Lines 67–75: What examples of hyperbole are in these lines? Describe their overall effect. Dwelling

"And the Raven, never flitting, still is sitting, still is sitting

On the pallid bust of Pallas just above my chamber door;

And his eyes have all the seeming of a demon's that is dreaming,

And the lamp-light o'er him streaming throws his shadow on the floor;

And my soul from out that shadow that lies floating on the floor

Shall be lifted—nevermore!"

Read the sentence.

Casey was extremely cocky and the thought that he might strike out never once crossed his mind.

Which word best replaces the word cocky to keep the connotation negative?


assured

arrogant

confident

certain

Answers

Answer:

arrogant

Explanation:

Arrogant has a similar meaning to cocky (usually meaning boldy self-righteous) and is frequently used to negatively describe someone's personality or actoins.

Arrogant, it is similar to cocky but it has a better rep as a word.

What is the main idea? *
Summarize the passage in your own words. *

Answers

Answer:

Or, while Ninjas stealthily negotiate their way through dark places (such as an enemy’s residence at night), ninjas used the scabbard as a walking stick, feeling or probing their way around objects so as not to knock into anything and alert the enemy.

Perhaps the ninja’s most sinister use of the scabbard was to put a mixture of red pepper, dirt, and iron shavings at the top of the scabbard, so that when the ninja drew his sword, his opponent would be blinded.

explain your interpretation of a passage or set of passages from The Diary of a Young Girl

Answers

Answer:I hope I will be able to confide everything to you, as I have never been able to confide in anyone, and I hope you will be a great source of comfort and support.

Explanation:Anne writes this on the inside cover of her diary just after she receives it for her thirteenth birthday. At the time, she feels that she does not have any true confidants, which makes her feel lonely and misunderstood. Anne does, however, have many friends and admirers, and she is a playful, amusing, and social young girl. Thus, her sentiments in this passage may seem odd and a bit exaggerated, but she later explains that even though she has friends, she is never fully able to open up to them. Anne finds that she and her friends talk only about trivial things, even when she has deeper things on her mind that she wishes to share. For example, she never broaches the subjects of her developing body or Germany’s occupation of Holland. Having a diary—which she addresses as “Kitty,” like a friend—enables her to express her thoughts without fear of being criticized by others. Anne’s relationship with her diary helps comfort her through her insecure, lonely, and fearful time in hiding.

Which statement best evaluates how well this narrative establishes a clear
focus?
My photography teacher always says, "The world looks different
through the lens." As a beginning photographer, I would look through
my camera lens and try to understand what he meant. Photos of
flowers bathed in sunlight simply looked like flowers in the midday
sun. In fact, all of my photo
subjects appeared exactly the same in my
camera lens as they did in real life. However, the day I photographed
my grandmother was the day I finally understood exactly what my
teacher meant.

Answers

Answer:

D

Explanation:

D is correct as his Teacher's photography tip is carried out through the passage

Answer:D

Explanation:

the jet rose in the sky. it soared like...?

Answers

Answer: the jet rose in the sky. it soared like an eagle

Which of the following are true of fables? Choose all that apply.

Fables are based on true events
Fables are short stories
Fables are about animals with human characteristics
Fables teach a lesson

Answers

Answer:

B. Fables are short stories

C. Fables are about animals with human characteristics

D. Fables teach a lesson

Other Questions
BRAINLIEST IF CORRECT which evidence best supports the following topic sentence? Another reason the school should open an after school computer lab is that the lab would offer safeguards for internet use that students do not get out of school. Consider the four organisms you see here. Each represents a specific kingdom. They all exhibit the characteristics of life. Think abouttheir life cycles. Compare and contrast the life cycles of the four. How do they differ?es ) El permetro de una circunferencia es de 40 cm, y tiene un ngulo de 130. Calcula el rea del sector de dicha circunferencia. Read each sentence below and identify the adjectives with the nouns they describe. Nancy was angry when Fred picked her up late A rectangle is 12 cm long and 8 cm broad.The length and breadth of the rectangle areboth increased by the same amount, dcm.If the area of the rectangle is now 221 cm,find the value of d. with a digram HELP PLEASE 1. 5x + 7 = 2x + 162. 3x + 4 = 5x 10 A wind turbine is most like a _______________A; windmillB; windsockPlease I need it for my test :( Consider the following argument: Any piece of software that is in the public domain may be copied without permission or fee. But that cannot be done in the case of software under copyright. So, software under copyright must not be in the public domain. The conclusion of the argument is: What does paragraph 4 reveal about George's change in attitude towardthe townspeople? *A. He realizes that they care about his well-being.B. He is worried they will make him miss his train.C. He becomes suspicious about their motives.D. He hopes they won't embarrass him any further. Maria says that the solutions of the inequality are y. Find, describe, and correct the error in Maria's work, shown here. if the pressure of a container is enlarged three times what will the pressure be? Write a paragraphexplaining how life in the West was different fromlife in the East. please help with this question?!? what is the mRNA in TACCGGATGCCAGATCAAATC? What is the mean for the data shown in the dot plot? 4 5 6 10 In a sequence of numbers, a4=3, a5=5, a6=7, a7=9, and a8=11.Which recursive rule can be used to find the nth term of the sequence, an? a1=3; an=an1+2 a1=3; an=2an1 a1=3; an=2an1 a1=3; an=an1+2 What are two elements of a governments foreign policies?promoting democracy within the countrys bordersforming military alliances with other countriesstrengthening international trade relationsproviding health care to citizens of the countryimproving the education standard in the country Need help real quick haha plsNumbers as answers only, no variables pls. thank u! :) Plz help is is my last 3 questions I will give you 50 points for helping I need help this is needed by tomorrow morning :)