Maria has written the following sentence: “Any student wishing to earn an internship must turn in his application to career services by Friday.” How could she revise her sentence to make it the most inclusive?

The sentence is inclusive as is.

“Any student wishing to earn an internship must turn in her application to career services by Friday.”

“Students wishing to earn internships must turn in their applications to career services by Friday.”

“Students wishing to earn an internship must turn in his or her applications to career services by Friday.”

Answers

Answer 1

Answer:

Students wishing to earn internships must turn in their applications to career services by Friday.

Explanation:

When using the word "their" it is including all students that may be male, female, or who might identify as non-binary.


Related Questions

Click to review the online content. Then answer the question(s) below, using complete sentences. Scroll down to view additional questions.
"Evolution of News Media and Social Media"

What are some responsibilities of the media? How has increased social media impacted citizens' ability to gain information.

Answers

Answer: D) In some religions, reincarnation is linked with karma.

Explanation:

assasa Secondary School 1" Semester English Mid-Exam for Grade 11 in 2015. 1. Choose the word that best completes the sentences from the given alternatives (A,B,C,D) all the work when you arrived have already finished B had finished C were already finished D already finished 2.Our house ten years ago was built B. would be built C. had been built DA The test we had yesterday was difficult, but the other we had last year were most difficult B.the more difficult C. difficult We will catch the bus more difficult we leave now. A if Bif not C unless D. when Height have failed the exam if he A. Hasn't studied The man BA B. hadn't studied C didn't study D. wouldn't study wife is our school director was assigned to be the mayor of our town. C. which D whose B This book BA If she D9 4 Although B. However INObaven't seen him who written by Nelson Mandela in 1980.A. had B. have C was D. may excrcises, she wouldn't be so far. A took B had taken C is taking D takes the fact that she had a bad cold, Amina played well in the net ball match C. Whic D In spite of a long time.A from B since Cin D for a decision next week about whether or not to buy a ring. 13. be done C make D do -^ A Be mude everything I can to you happy make/do D. made/do​

Answers

honestly not sure what the answer is but hope you find the explanation

What is the ability to show you are strong on the outside?

Question 19 options:

empathy

self-awareness

self-confidence

behaviors

Answers

self awareness (i do believe) so sorry if i’m wrong

What question can you ask to figure out what prior knowledge you have?
O A. How should I start?
OB. Do I have time to read this now?
C. Why am I reading this?
OD. What do I know?
SUBM

Answers

Answer:

OD. What do I know?

Explanation:

The things you know already make up your knowledge.

Knowledge: Facts that a person accumulates based on education and/or past experiences.

I need help ------------

Answers

Answer:

a. should

b. can

c. should not

d. should not

e. should

(correct me if im wrong ty)

Explanation:

Answer:

The answer is

a. should

b. should not

c. cannot

d. should not

e. should

Explanation:

Choose the best of these words to complete each of these sentences about using keys. Note that in some cases, more than one answer is possible.

Can, cannot,  Should, should not

a.  You should work through each question in turn when you are using a key.

b.  When you use a key to identify an organism, you should not try to identify more than one organism at the same time.

c. A dichotomous key cannot have more than two choices each time.

d . A key should not have too many different questions.

e. A good dichotomous key should help you to identify an Organism quickly.

Which of the following best describes the backfire effect?

1. The psychological explanation for weak algorithms

2. Your brain’s natural response to common information

3. A biological way of protecting a person’s worldview

4. The proper term for negative responses on social media

Answers

A biological way of protecting a person’s worldview best describes the backfire effect. Thus, option C is correct.

What is a backfire effect?

The backfire effect is regarding the deals that a person usually makes. It is with respect to the changes or the developments that have been happening and to have a positive aspect on it.

Regardless of being given absolutely solid information that contradicts them, bolstering a person's views is a bad idea. a false sense of reality. putting faith in concepts and ideas without proof supporting their validity.

Therefore It is doomed to be necessary that the worldwide perspective is taken into care. This is usually given to protect the person's view. Therefore, option C is the correct option.

Learn more about backfire effect, here:

https://brainly.com/question/21876570

#SPJ1

what do you fear that you can try to overcome this year? (answer in first person pov like i'm writing it)

Answers

Answer:

Getting a low score/Grade hha

Explanation:

Q45 Slaughterhouse Five: Who is the person who inspired Billy to frame “God grant me the serenity [...]” on his office wall?

Select one:
a. Valencia Merble
b. Kilgore Trout
c. Bertrand Copeland Rumfoord
d. Montana Wildhack

Answers

Answer:

c. Bertrand Copeland Rumfoord

Read the following scene.
Nancy yawned and stretched her arms. She dressed
slowly, jeans, T-shirt, and then her favorite boots. Then she
checked the clock and hurried her pace. She had to be on
time today, or Mr. Berber would reprimand her again. Even
if you arrived right at the bell, he sent you to the office. She
grabbed her purse and ran out the door.
Which is the strongest evidence from the passage that the character is
getting ready for school?
A. She dressed slowly, jeans, t-shirt, and then her favorite boots.
B. Even if you arrived right at the bell, he sent you to the office.
OC. Nancy yawned and stretched her arms.
D. Then she checked the clock and hurried her pace.

Answers

Option b is Correct. The passage's best indication that the character is getting ready for school is the sentence "Even if you came just at the bell, he sent you to the office."

The mention of the bell would be the best response. The mention of the bell indicates that they are heading to a school rather than to work, even if the rest of the sentence seems to be talking about someone who works in an office.

Nancy stretched her arms while yawning. She put on her beloved boots after putting on her favorite pants and T-shirt. She hurried her pace after checking the time. She had to be on time today to avoid receiving another reprimand from Mr. Berber. even if you got there just as the bell rang.

To know more about evidence click here: brainly.com/question/1256677

#SPJ1

Reread paragraphs 1-3. What text structure is starting to emerge from details of the teens' lives? Exp whether the author used this text structure effectively. An editorial writers' purpose is to try to persuade their audience to agree with their opinions and proposals. Did David Brooks achieve his purpose? Explain, considering your own response to the editorial.​ the book is the power of a dinner table.

Answers

The descriptive text structure is emerging from the details of adolescents' lives. Brooks' goal was achieved during the book.

Why was Brooks' goal achieved?Because he was able to convince the reader about the transforming power of love.Because he was able to show how unfair American society is.Because he managed to show how social inequality is degrading.

David Brooks managed to persuade the public who read his text, achieving his goals as a writer and as a text editor.

This is because he continued to show how degrading is the life of young people who live in extreme poverty and are the main victims of social inequality.

This kind of life limits young people leaving them sad, wronged, and without the strength to change their lives. These feelings are shown through a descriptive structure, which presents many details of the young man's life and convinces the reader about how much American society is unfair to the neediest.

However, young people get the strength to fight against their problems through positive feelings like love, which has the ability to change their lives, showing the reader that this type of feeling is liberating.

Learn more about textual structure:

https://brainly.com/question/12053427

#SPJ1

Which detail about the children is best supported by the text?
A.
the difference in people's reactions to the babies
B.
the idea that the babies brought joy to their families
C.
the way that babies are unaware of what people think
D.
the typical care of babies in the sixteenth century

Answers

The detail about the children is best supported by the text is the difference in people's reactions to the babies. Thus, option A is correct.

What is people's reaction?

Reactions are instinctive and originate in the subconscious mind. When you react in a circumstance, there is no filtering process; you are on autopilot. When you respond, you do and say things without first thinking about them and without considering the consequences of what you do or say - you simply act.

The text's best evidence for the information about the children is the variance in people's reactions to the newborns. Therefore, it can be concluded that, option A is correct.

Learn more about reaction here:

https://brainly.com/question/28984750

#SPJ1

unit 2 pretest: Realizing dreams

Answers

He struggled for a long time before failing because his sails were too frail to withstand the wind, which best illustrates the idea that it's crucial to maintain one's dream-focused attitude.

In what way does the poem "He Had His Dream" portray its theme?

He set out to achieve his dream via struggle and labor his entire life. Which concept does this poem express? You can get through life's challenges by having determination.

Hold Fast Your Dreams has a theme, what is it?

Never give up on your dreams is a topic that could be present in this poetry. The poem's line, "Within your heart Keep one still, secret nook Where dreams may wander," establishes this as the focus. This, to me, is a reminder to treasure your dreams.

To know more about one's dream-focused visit :-

https://brainly.com/question/9971419

#SPJ1

Can someone help me with this question?

Answers

Answer:

Change "whats" to "what's"

Explanation:

"What's for dinner" is like asking "what IS for dinner". If you said "whats for dinner" you'd be implying that WHAT (as in that is the name of something) is for dinner.

Hope that helps

In "To His Excellency George Washingon " the speaker's purpose is mainly to General Washington.

Answers

Answer:

Yes, the speaker's purpose in "To His Excellency George Washington" is mainly to praise and thank General Washington for his service and leadership.

Explanation:

Read the sentence below.

Fallen from its tree, the apple was bruised.

The underlined part of the sentence can best be described as a/an...

The underlined part is “ Fallen from its tree”

Select one:

verb phrase.

absolute phrase.

prepositional phrase.

participle phrase.

Answers

The phrase "Fallen from its tree" (which is highlighted) is the verb phrase used to describe how the apple was damaged when it fell from the tree.

An illustration of a verb phrase?

A verb, a main verb that follows a modal or one or more auxiliaries, or both make up a verb phrase. 'Walked,' 'can see,' and 'had been waiting' are some examples.

What distinguishes a verb phrase in a sentence?

A verb phrase consists of the main verb and one or more supporting verbs. Helping verb(s) with the primary verb make up verb phrases. Helping verbs aid a verb's ability to convey time or a state of being. A verb phrase can have one or more verbs next to one another, or in the case of questions, two or more verbs.

To know more about verb phrase visit :-

https://brainly.com/question/907028

#SPJ1

Part B
Write an analysis of the poem from the New Criticism perspective, closely examining the form and content of the text itself
without any reference to the historical or blographical context or to your personal response to the poem.

Answers

Answer:

The poem “The Red Wheelbarrow” by William Carlos Williams is a short yet powerful poem that packs a lot of meaning into its few words. From a New Criticism perspective, this poem can be analyzed in terms of its structure, language, and imagery.

Structurally, the poem is composed of four short lines of varying length, which creates a sense of emphasis on certain words and syllables. This structure also gives the poem a sense of balance and unity. The poem begins and ends with two words of similar length and meaning, creating a circular structure that symbolizes the cyclical nature of life.

The language of the poem is simple and direct, using everyday words to convey a profound meaning. The words chosen are carefully chosen to evoke vivid images in the reader’s mind, such as the “red wheelbarrow” and the “white chickens”. These images also contain a deeper meaning, as the wheelbarrow and the chickens represent the labor and the fragility of life.

The poem also contains a strong element of imagery. The imagery of the wheelbarrow, the chickens, and the rain are all used to create a vivid and powerful image of the cycle of

If you want a word origin, you can use a
OA. homograph
OB. demographic
O C. thesaurus
OD. dictionary

Answers

Answer:

your use the thesaurus.

apart from finding better weather what other things do animals migrate for answer​

Answers

Answer:

Animals migrate for a variety of reasons, including to find better food sources, to reproduce, and to avoid predators. Some animals migrate in response to changes in daylight or temperature.

Explanation:

Need help now only have like 10 min
Chores Spritz, clean, scrub. Wipe, swipe, rub Pane after pane. Windows are a waste! Unless…

I share the clouds with a flock. A soaring clone of hollow bone swooping far. A feathered drone.

Splash, brush, slosh. Plunk, dunk, wash. Pan after pan, Dishes are a drag! Unless...

I breach the waves with a pod. A humpback blip at breakneck clip surging high. A hulking ship.

Scrape, gouge, stab Smack, whack, jab. Weed after weed. Gardening is a grind! Unless…

I crawl the depths with a knot. A squirming pal of dirt know-how digging deep. A stretchy plow. Seek, thirst, scheme Think, drink, dream, Wish after wish. Chores disappear. Yes!
Select the word from the drop-down menu that completes the sentence. The pattern of beats in “Chores” creates Choose
A. Rythm

B. Rhyme

C. A Stanza

D. A verse

Answers

Answer:

B. Rhyme

Explanation:

Examples include: pane/swoop, pan/wash, pan/weed, pod/ship, knot/plow, and wish/disappear.

Authoritative teachers do which of the following actions?

Question 1 options:

Focus on their personal needs and agendas before the children's.


Focus their comments to children on what children have done wrong.


Encourage and reward certain behaviors.


Let the children guess the expectations from them.

Answers

Authoritative teachers do the actions of C. Encouraging and rewarding certain behaviors.

How to illustrate the information?

Not every method of instruction is created equal. What is successful in one classroom might be a complete failure in another. Demanding that teachers always be authoritative as opposed to authoritarian or permissive is not realistic. Too many different interactions take place in classrooms for one particular style to be required constantly.

Teachers who have authority are firm but fair. They establish rules and consistently uphold them, but they also value the opinions of their students. The teacher will graciously accept suggestions from students and make any necessary changes if they have criticism of the rules of the class or suggestions to enhance the learning environment

Based on the information, it should be noted that such people reward certain behaviors. The correct option is C.

Learn more about teaching on:

https://brainly.com/question/13812142

#SPJ1

Identify which is an in-text citation and which is a works cited entry.
Eck, Joe. Our Life in Gardens. Farrar, Straus, and Giroux, 2009.
According to Franck et al., "Current agricultural policies in the U.S.
are contributing to the poor health of Americans" (327).
Romantic poetry is characterized by the "spontaneous overflow of
powerful feelings" (Wordsworth 263).
Adams, Clifton R. "People Relax Beside a Swimming Pool at a
Country Estate Near Phoenix." Found, 2 June 2016,
natgeofound.tumblr.com/. Accessed 15 Jan. 2019.
[Choose ]
[Choose ]
[Choose ]
✓ [Choose ]
in-text citation
Works Cited entry

Answers

The purpose of an in-text citation is to make it clear to the reader where you got your information. Including references and a writer's list of sources used to create a text is called a works cited page.

What is the purpose of in-text citation?

Every time you use a quotation from or paraphrase a source in your writing, an in-text reference is required. When you quote, you really use the original author's words in your own writing, generally after a signal phrase. Quotes should always be credited (and denoted with quotation marks) together with the page number of the source where they were taken from.

Examples of in-text citation:

  According to Franck et al., "Current agricultural policies in the U.S.

  are contributing to the poor health of Americans" (327).

 Romantic poetry is characterized by the "spontaneous overflow of

  powerful feelings" (Wordsworth 263).

What is the use of works cited?

A writer uses a Works Cited page to acknowledge the sources they consulted while creating a work. Giving attribution helps authors prevent plagiarism, which is the practice of misrepresenting the authorship of someone else's works. Plagiarism is disrespectful to the authors of other materials and can damage an author's academic reputation. Writers must be open and upfront about which ideas were their own and which ones they borrowed from other sources in order to be perceived as a reliable source of information.

Examples of works cited:

Eck, Joe. Our Life in Gardens. Farrar, Straus, and Giroux, 2009.

Adams, Clifton R. "People Relax Beside a Swimming Pool at a

Country Estate Near Phoenix." Found, 2 June 2016,

natgeofound.tumblr.com/. Accessed 15 Jan. 2019.

To learn more about citation visit:

https://brainly.com/question/1272936

#SPJ1

The heart that feels not now is dead. The blood of his children will curse cowardice

Answers

Thomas Paine's "The Crisis No. 1" makes extensive use of metaphorical language to persuade the reader that America needs to be free of Great Britain.

What is figurative language?

Basically, using figurative language means stretching the meaning of words for impact, whether it's to sound creative, crack a joke, or just make a point.

In narrative writing, when the author aims to evoke strong feelings in the reader, figurative language is a typical strategy.

The Crisis No. 1 by Thomas Paine extensively use metaphorical language to convince the reader that America must be freed from Great Britain.

In the section that is being read, Paine employs figurative language to make the reader feel guilty for putting their own survival—or "cowardice," as he calls it as above the wellbeing of the group or "the whole."

Thus, this is the purpose of the figurative language.

For more details regarding figurative language, visit:

https://brainly.com/question/2569664

#SPJ1

What major event has had the biggest impact in your life

Answers

the major event that has had the biggest impact of my life was covid 19

Which of the following is a correctly cited anthology?
A. Goldoni, Carlo. "The Servant of Two Masters." The Classic Theater. Eric Bentley, New York: Anchor Books. 145-236.
B. Goldoni, Carlo. "The Servant of Two Masters." The Classic Theater. New York: Anchor Books. 145-236.Ed. Eric Bentley
C. Goldoni, Carlo. "The Servant of Two Masters." The Classic Theater. Ed. Eric Bentley, New York: Anchor Books. 145-236.
D. Goldoni, Carlo. "The Servant of Two Masters." The Classic Theater. New York: Anchor Books. 145-236. Eric Bentley

Answers

Goldoni, Carlo. "The Servant of Two Masters." The Classic Theater. Ed. Eric Bentley, New York: Anchor Books. 145-236 is a correctly cited anthology.

What is anthology?

An anthology is a collection of literary works, such as poems, short stories, plays, or essays, that are gathered into a single volume for publication. An anthology can include works from a single author, multiple authors, or even works from different time periods or genres. An anthology can be used to highlight the best works of a particular author or to explore the works of many authors. Anthologies can be published as books, magazines, or on websites. Anthologies are often organized thematically or by genre and can be used to introduce readers to unfamiliar styles or movements in literature.

To learn more about anthology
https://brainly.com/question/2396800

#SPJ1

Based on the events of the text, which answer choice best states the author’s position in “The fish I can’t catch”?

Answers

Answer:

The author's position in "The fish I can't catch" is that life is unpredictable and that we should embrace the moments of joy and contentment that we are able to find.

Explanation:

WILL MARK BRAINLIEST!! PLEASE HELP!!

Underline for the following each present participle phrase. Then bold the word it modifies:

1) It wasn't his disreputable rags, nor the toes peeping out of one blue and one brown canvas shoe, nor the two stars of his rank that troubled Jonathan.

2) Then he made the journey to Enugu and found another miracle waiting for him.

3) Soon many people came out of their forest holes looking for the same things.

4) He paid the pounds, and moved in with his overjoyed family carrying five heads on their shoulders.

Answers

A participle phrase must contain a participle, past or present, and since it functions as an adjective, it must modify a noun or a pronoun, as seen below.

It wasn't his disreputable rags, nor the toes peeping out of one blue and one brown canvas shoe, nor the two stars of his rank that troubled Jonathan. - modifies "toes".Then he made the journey to Enugu and found another miracle waiting for him. - modifies "miracle".Soon many people came out of their forest holes looking for the same things. - modifies "people".He paid the pounds, and moved in with his overjoyed family carrying five heads on their shoulders. - modifies "family".

What is a participle phrase?

A participle phrase, or participial phrase, is basically a group of words in which the most important word is a participle. Present participles end in -ing, and past participles, when regular, end in -d, -ed, or -ied. Irregular participles have their own specific form. Examples:

Present participles: doing, going, swimming, writing, carrying.Past participles: done, gone, swum, written, carried.

With all that in mind, we can conclude we have correctly underlined the participles phrases in each sentence and identified the nouns or pronouns they modify. To do so, we used the knowledge that participle phrases function as adjectives would in the sentence.

Learn more about participle phrases here:

https://brainly.com/question/27585394

#SPJ1

How does Friar Lawrence feel about how the Prince chose to punish Romeo in Act III of Romeo and Juliet, when he is explaining it to Romeo?
A. Romeo is lucky.
B. Romeo's punishment should not be taken seriously.
C. Romeo is being punished excessively.
D. Romeo's punishment fits the crime.

Answers

A is the answer because he encouraged Romeo to count his blessings since he could’ve been executed as well.

PLEASE HELP In the poem "I Wandered Lonely as a Cloud," which of the following is an example of personification?


I wandered


Beside the lake, beneath the trees


The waves beside them danced


I gazed—and gazed—but little thought

Answers

Option three is the answer.

Explanation: Personification is when something nonliving is doing something a human does. Therefore, it makes sense the third option is right because in it the waves are dancing and they can’t dance since they’re nonliving.

How does the structure of the poem help
develop the speaker's message? Ode to solitude

Answers

The poem "Ode on Solitude" by Alexander Pope is lovely and serene. It declares the speaker's intention to have a good, uncomplicated life and avoid public attention.

How does the poem's organization aid in the development of the speaker's message?

Each one will have been specifically picked by the poet to enrich the poem's meaning. A poem's rhyme system in particular can be used to highlight particular concepts. A poem with repeated stanzas or phrases may affect the reader emotionally quite differently than a poem with no repetitions. The central premise of the poem is that true happiness can only be found in total solitude. However, the speaker believes that this seclusion must not be fleeting or sporadic.

To know more about solitude visit:

brainly.com/question/2458478

#SPJ1

According to the introduction, how does the lecture Randy presented relate to this book?

Answers

Positive Attitude and Actions In The Last Lecture, Randy acknowledges that his attitude cannot alter the reality that surrounds him, but he contends that it may alter how he responds to and engages with that reality.

What is the point of Randy Pausch's most recent lecture?

It was about how important it is to overcome challenges, support other people's aspirations, and take advantage of every opportunity. It encapsulated everything Randy had learned to believe. Living was the subject.

What occurs after the final lecture?

Randy talks about his desire for his children near the end of the book, saying that he wants them to have their own dreams and be passionate about pursuing them.

To know more about The Last Lecture visit :-

https://brainly.com/question/14259241

#SPJ1

Other Questions
What is human trafficking Which of the following statements best explains differences between the finches? A. Some finches were born with beaks that allowed them to have better access to different sources of food. These finches reproduced and passed on their genes.B. The beaks of the finches changed so all of the finches could eat the same types of food.C. The beaks of the finches changed as the species of finches migrated to the same island.D. The beaks of the finches changed as the finches' body sizes changed. The characteristics of type one diabetes Factor quadratic trinomials2x^2+7x+63x^2+5x+2With method X pleaseee:( How do you graph a parent graph? Do you agree with Wittgenstein that philosophy should focus on language? Why or why not? Cultural differences that might influence the guest service experience include all of the following except diet greetings humor marriage What was the Selective Service Act and how did it impact the war? When considering the various resources factors of production which of the following is most likely to represent capital? Find the area. The figure is not to scale You can NOT have an in group without having an out group True False 3 chairs and 4 tables cost rs 7540. if the price of a chair is 220 find the price of table?ans - 7120 two equivalent ratios for 17:5? Click on the edit DNA, you will now see the original sequence used to make the protein. ATGCCGGGCGGCGAGAGCTTGCTAATTGGCTTATAA The table below shows information about how many fans there were at twofootball matches in a local tournament.What is the difference between the number of away fans at the semi-final and atthe final?Semi-finalFinalTotal number of fans250400Ratio of home fansto away fans6:47:3 Follow the constitution and the law even if I disagree with it what power or duty is this listed on Nika rolls an 8-sided cube with faces numbered 1 through 8. Which of the following statements is true? P(even number) = P(odd number) = P(number less than 8) = 1P(the number 9) = 1 Why might Great Britain's colonies have contributed tothe start of Ine Industrial Revolutionin Great Britain? What is irony What are the 3 types of irony and examples of each? Which question is a statistical question?A. How tall is the oak tree?B. How much did the oak tree grow in one year?C. What are the heights of the oak trees in the schoolyard?D. What is the difference in height between the oak tree and the pine tree?