How did Hurricanes Katrina and Rita affect Louisiana’s economy? Check all that apply.


The oil industry severely slowed down due to the impact of the two storms.

The oil industry was forced to close completely and move to other regions.

The oil industry became established when other energy industries went into decline.

The oil industry picked up as demand for energy products increased after the storms.

How Did Hurricanes Katrina And Rita Affect Louisianas Economy? Check All That Apply.The Oil Industry

Answers

Answer 1

Answer:

A. The oil industry severely slowed down due to the impact of the two storms.

Answer 2

Answer:

its a

Explanation:

PLEASE MARK BRAINLIEST!!!!!!

How Did Hurricanes Katrina And Rita Affect Louisianas Economy? Check All That Apply.The Oil Industry

Related Questions

How did the mandates after World War I create conflict in Southwest Asia?

A. Jews and Arabs were given their own separate mandates.
B. Mandates were forced to adopt French or English as an official language.
C. Mandates were required to adopt democratic forms of government.
D. The borders of mandates often ignored ethnic and religious divisions.

Answers

Answer:

the answer is D "The borders of mandates often ignored etc.."

Explanation:

its a true fact and its logic

Please write a short paragraph explaining: What is the purpose of having nicknames? What is Arkansas's
currcnt nickname and why? If a new state nickname were ordered by the governor's office, what should it be and
why?

Answers

Answer:   The name lives on, thanks to the Rackensack Folklore Society, the ... The association's most dynamic advocate was former governor Charles ... Though official, the nickname did little to change popular perceptions of ... had,” and adopted “The Land of Opportunity”

Explanation:

They made nicknames to tell them apart

FREE BRAINLIEST

How does Document 2 support the view of the Mongols as not being "barbaric"?

Answers

Answer:

it doesnt bro

Explanation:

Answer:

hi its me dude can i have brainliest?

Explanation:

Why were boys educated differently than girls in ATHENS and SPARTA??

Answers

Spartan boys left their homes at 7 to be trained to become part of the army and defend Sparta. Their education was strict and focused around physical strength. Boys under 17 also learned reading, writing, dancing and singing. Older boys trained for the army, learnt survival techniques and finally joined the army when he turned 20.

Spartan Girls stayed at home until they were 18 years old. This was primarily so that they were fully mature when they had to marry, therefore increasing the chance of a strong healthy Spartan baby. Boys and girls were kept apart from the age of 7. Female Spartans wore short dresses with slits down the sides for practicality and improved mobility.

Athen Boys began drinking wine at the age of 3, and began school at 7. There they were taught math, to read and write and to play a musical instrument. Physical education was extremely important in Athens as well as Sparta, and sports included Archery, wrestling and swimming. More wealthy were taught to ride a horse. By age 18 all boys were expected to attend military school. By age 20 they graduated. In Athens, it was often the case for boys to reach the age of 30 before they participated in politics. It was also around this age that they usually married.

Girls in Athens stayed at home until they were married. They could not choose who to marry, all was decided by their fathers. Once they gave birth their fathers could not take them back, and it was very difficult for a woman to divorce her husband. Whilst at home, all girls learned domestic jobs such as weaving, taking care of children, embroidering, and cooking. Girls were able to attend festivals, funerals and sometimes visit neighbors.

Explanation: I hope this helps :)
Children were educated in order to produce good citizens for Athens, though only men were considered citizens. ... Girls were educated at home with the goal being they would become homemakers themselves, they were only taught to read and write if their mother, or private help would do so.

What are some solutions to solve the problem of companies moving overseas, because of lower labor cost in other countries?

Answers

          ✧・゚: *✧・゚:*  Answer:  *:・゚✧*:・゚✧ ✅ The only way to deal with inexpensive premium imports is for manufacturers to protect sourcing from abroad. They tell it allows US industry to reclaim their world status and go back to cheap labor-minded countries like Mexico, Taiwan and Malaysia. General approval from economists. The migration to low-wage regions is regarded as a result of shifts in the international competitive advantage. ~ ₕₒₚₑ ₜₕᵢₛ ₕₑₗₚₛ! :₎ ♡           ~

How was Israel impacted by surrounding nations and empires from its earliest days up to the beginning of the 20th century? Pleas no links. Answer ASAP

Answers

Answer:

The nation of Israel is the world's first Jewish state in two millennia. It represents for Jews the restoration of their homeland after the centuries-long Diaspora that followed the demise of the Herodian kingdom in the 1st century ce. As such, it remains the focus of widespread Jewish immigration.

Explanation:

pa Brainliest

What is the Taj Mahal? Explain who had it built and for what purpose.

Answers

Answer:

Often described as one of the wonders of the world, the stunning 17th Century white marble Taj Mahal was built by Mughal emperor Shah Jahan as a mausoleum for his beloved wife Mumtaz Mahal, who died in childbirth.

Explanation:

Answer:

Taj Mahal is one of the seven wonders of the world, built by  Shah Jahan to show his love towards his wife Mumtaz Mahal, who had tragically died from postpartum hemorrhage. Taj Mahal is made of pure White Marble, it is known for it's preserved beauty to this day and is visited by hundreds to thousands of tourists.

Here is a picture of Taj Mahal if your curious of how it looks:

Hope this helped!

How was the tie broken in the election of 1800?

Answers

the House of Representatives voted to break the tie.

At the end of Chapter 18, what new secret does Colin have in the secret garden book? NO LINKS!


People think that he is going to die.


Dickon's pets are named Captain, Soot, Nut, Shell, and Jump.


Mary found the secret garden.


Dickon will come to visit him.

Answers

Answer: Colins secret is Mary found the secret garden

Explanation: I read over the book Hope this helps! :)

Answer:

Mary found the secret garden.

Explanation: I red over the book Hope this helps! :)

What were the types of nuclear bombs created in the 1940s and 1950s?

Select all that apply.

Select 2 correct answer(s)
Question 2 options:

atomic bomb


hydrogen bomb


neutron bomb


napalm bomb

Answers

Hydrogen and Atomic.

Neutron bomb is actually a theory and hasn’t even been invented yet.
The napalm bomb was made during the 70s for the Vietnam war.

Hope that helps, have a good day.
Atomic and Hydrogen.

What was one reason for Genghis Khan’s success as a military leader?

Answers

Answer: He organized the Mongolian army into an efficient fighting force.

Answer:

He trained the mongolian army to be a strong army.

Explanation:

The U.S. Constitution most reflects the principle of limited government by –

A. letting people over the age of eighteen vote
B. allowing the President to only serve two terms
C. allowing states to coin money
D. making the President the Commander in Chief of the armed forces

Answers

B
Because it puts a limit on the amount of years the president can serve
I think the answer is B

which statement does texas's age distribution suggest about the state's population?

a. texas has a high birth rate
b. texas has a high death rate
c. the population of texas is declining
d. the percentage of children in texas is shrinking

no links, or u will be reported.

Answers

Answer:

on average 5-34 so it's D

Explanation:

The population of texas age distribution suggests about the state is based on the percentage of children in texas is declining. Thus option D is correct.

What is texas age distribution?

The texas age distribution refers to the distribution of the age-specific population within the region or area. Texas has a declining child population under five years is 7.8 which is going on the decline to 7.4 at the age of 24. Thus on average, the total child population is 6.9%.

Find out more infirmation about the population.

brainly.com/question/1437549

The pope is the bishop of Rome and is also the leader of the other bishops

True
or
False

Answers

I think that it is false I’m not really sure because I haven’t learned this
it is definitely false!

What best describes the main idea of Chapter 11?

a The Industrial Revolution changed the North.
b The South was richer than the North due to cotton.
c The North and South developed distinctly different identities in the Industrial Revolution.
d The North and South remained unchanged due to industry.

Answers

I think it’s b I hope this work
the correct answer is a

the south was poor the north was rich because they grew from industrialization. the south used cheap labor (slaves)

hope this helps :)

Free brainliest

How does Document 2 support the view of the Mongols as "barbaric"?

Answers

Answer:

The Mongols were somewhat barbaric because there were many parts of their civilization that were advanced. Documents 2,3,4,5 and 10 show how the Mongols were barbaric. In document two, it says that in battles, if one man ran away the whole group of men would be put to death.

Explanation:

write a short poem using at least 4 of Shakespeare's phrases.

Answers

Answer:

although as wish, I shall prove to whom

I'll seek forge before I lay in doom

the worldliness of me as I sit down untree

I shall prove to whom what I must do

poop, ie
ypoopy
p
oopy

Why did people move to Minnesota’s urban areas at the turn of the twentieth century?

Answers

Answer:

Why did people move to Minnesota's urban areas at the turn of the 20th century?

Because there was work in these areas

Pretend that you are a Roman teenager. What is something that you'd like to ask your parents for, but you think they'll need some convincing to say yes? Perhaps you want to have a friend spend the night on Friday or you'd like to go to the Forum for the first time. Let's practice your rhetorical skills. In a letter to your parents, outline the pros and cons of letting you have your way, and be sure to conclude with why they should be persuaded to support your choice. Good luck!

Answers

Answer:

Mother and dear father, let me increase your knowledge on why i should

Explanation:

What is the capital of Prince Edward Island?

St. John's
Fredericton
Charlottetown
Halifax

Answers

Answer:charolottetown

Explanation:

Please help describe the following image

Answers

The following images are political views that are very true lol
Yes it is because that’s how most people see them

Can someone pls help me?

Answers

Explanation:

Step 1: The Anaconda plan was to completely blockade all ports that were in any way related to the southern territories. By blocking all ports, they would prevent them from ever leaving the territory. This step was conducted by the Navy.

Step 2: It was about cutting it off from help from the Americas. It was about a continental blockade where the southerners would be surrounded from all sides, from Northern states in the north, to northern blockades in the East and West.  

Who chose our official state symbols? (New Mexico)

Answers

Harry Mera of Santa Fe
A contest to design the new state flag was won by Harry Mera of Santa Fe, New Mexico.

This is due tomorrow so please help me fill in the blank.

Answers

Answer:

Socrates

Explanation:

Socrates was accused of corrupting the youth of Athens and sentenced to death

^^ what the other person said

these sentences describe conditions after the fall of the Roman and gotha Empires match each description to the correct Empire Invaders destroyed Hindu temples powerful Lords broken empire into separate kingdoms without trade people had to find their own food and basic necessities the feudal system began as people turn to Lourdes for protection Kunis were absorbed into the local culture knowledge of math and science was lost




i'm at lost some one help me TwT​

Answers

What year are you in?

Please help! I will give brainliest!

Answers

Answer: c

Explanation:

3. Which level of government makes the furthest-reaching economic decision?

Answers

Command Economy also called Centrally Planned Economy

What major industries emerged in the decades after the Civil War?
Please I need this ASAP

Answers

Answer:

In the decades after the Civil War, many major industries emerged, including the railroad, oil, and steel industries.

The railroad, oil, steel, etc etc

I didnt realize this was due, please help! You have learned about the history and basic beliefs of communism. In this report, you will learn more about communism in an Eastern European country.

Here is your goal for this lesson:

Research a communist country


Choose any country (or a city within the country) that you have studied in this unit. These include Russia, Poland, The Czech Republic, Slovakia, Hungary, Germany, Romania, Bulgaria, Albania, Croatia, Macedonia, Slovenia, and Bosnia-Herezegovina. Using the Internet, an encyclopedia, or other resources, research the period of communism in the chosen country, and write a report in which you describe what life was like for the citizens during the era of communism. Your report should be approximately 300 words in length.

Answers

Answer:

ggg

Explanation:

The statue of Lincoln ___.


was carved from one large piece of marble

was made up of twenty pieces of marble

is standing in front of a chair

has developed a patina due to age
please dont answer if you dont know

Answers

the answer is A it was made from a piece of georgia marble have a good day !
Other Questions
A wind turbine is most like a _______________A; windmillB; windsockPlease I need it for my test :( Consider the following argument: Any piece of software that is in the public domain may be copied without permission or fee. But that cannot be done in the case of software under copyright. So, software under copyright must not be in the public domain. The conclusion of the argument is: What does paragraph 4 reveal about George's change in attitude towardthe townspeople? *A. He realizes that they care about his well-being.B. He is worried they will make him miss his train.C. He becomes suspicious about their motives.D. He hopes they won't embarrass him any further. Maria says that the solutions of the inequality are y. Find, describe, and correct the error in Maria's work, shown here. if the pressure of a container is enlarged three times what will the pressure be? Write a paragraphexplaining how life in the West was different fromlife in the East. please help with this question?!? what is the mRNA in TACCGGATGCCAGATCAAATC? What is the mean for the data shown in the dot plot? 4 5 6 10 In a sequence of numbers, a4=3, a5=5, a6=7, a7=9, and a8=11.Which recursive rule can be used to find the nth term of the sequence, an? a1=3; an=an1+2 a1=3; an=2an1 a1=3; an=2an1 a1=3; an=an1+2 What are two elements of a governments foreign policies?promoting democracy within the countrys bordersforming military alliances with other countriesstrengthening international trade relationsproviding health care to citizens of the countryimproving the education standard in the country Need help real quick haha plsNumbers as answers only, no variables pls. thank u! :) Plz help is is my last 3 questions I will give you 50 points for helping I need help this is needed by tomorrow morning :) How did the protests change during the 1960s?Choose all correct answers.Women and Mexican Americans joined other groups to protest inequality.College students organized more silent, peaceful marches than they had in earlier years.Riots in major cities led to destruction and death. Why the allied powers pinpointed Germany at the person guilty for starting world war 1 How did the mandates after World War I create conflict in Southwest Asia? A. Jews and Arabs were given their own separate mandates. B. Mandates were forced to adopt French or English as an official language. C. Mandates were required to adopt democratic forms of government. D. The borders of mandates often ignored ethnic and religious divisions. I have of an hour to finish 6 homework assignments. How much time can I spend on each assignment? Mention the ways of safe abortion(like what should the woman do??)need help fast what is a flowchart and write it's work