Explanation: Carbohydrates are mainly composed of Oxygen, Carbon and Hydrogen. the most popular carbohydrate that is compatible with the human body is glucose which is the final result of every Carb we take in. a glucose molecule has 6 carbon atoms. during glycolysis, a single glucose molecule is broken down into two pyruvate molecules. in there, the first couple of ATP is synthesized. at later steps of the cycle, more ATP molecules are reduced.
Hat percent of electricity in the UK will come from renewable sources by 2010? a. 1% c. 10% b. 5% d. 40%
Answer:
C, 10%
Explanation:
For the year of 2010, it's definitely 10%
Hello! could someone please do a 4 sentence quark poem
Answer:
Quark is a character in the television series Star Trek: Deep Space Nine.
Quark developed a few strong friendships during his stay on Deep Space Nine.
The Ferengi have business deals throughout the galaxy; Quark is no different.
For vegetarians, soft cheeses like cream cheese and quark do not contain any rennet at all.
Explanation:
Essay Question: Which two species are more closely related?
Answer:
mannimals;humens and animals
Explanation:
During fertilization, sperm cells will either contain an x or a y chromosome in addition to 22 other chromosomes, totaling______
give an example of something that might stop a cell from checking things during the cell cycle
Answer:
A checkpoint is one of several points in the eukaryotic cell cycle at which the progression of a cell to the next stage in the cycle can be halted until conditions are favorable. ... The G2 checkpoint ensures all of the chromosomes have been replicated and that the replicated DNA is not damaged before cell enters mitosis.
A mutation in a tumor suppressor gene may stop a cell from checking things during the cell cycle.
Tumor suppressor genes are normally expressed genes that control the progression of a cell through the cell cycle.These genes (tumor suppressor genes) act to repair mutations that occurred during DNA replication, slow down cell division, activate programmed cell death pathways (i.e., apoptotic pathways, etc).For example, p53 is a tumor suppressor gene capable of controlling cell division rate by keeping cells from proliferating in an uncontrolled manner.In consequence, mutations of the p53 gene are often observed in cancer cells that lost their ability to regulate the rate at which they grow.In conclusion, a mutation in a tumor suppressor gene may stop a cell from checking things during the cell cycle.
Learn more in:
https://brainly.com/question/16188646
How about decreasing the amount of water in blood affect blood pressure
Answer:
When you're very dehydrated, your blood volume can decrease, leading to a drop in blood pressure. When blood pressure drops too low, your organs won't receive the oxygen and nutrients they need. You could potentially go into shock.
Enumerate ways on how humans produce sound:Ex:clapping your hands
a.__________________________
b.__________________________
c.__________________________
d.__________________________
e.__________________________
Answer:
vibrating vocal cords, stomping feet, gargling, whistling, cracking your knuckles
Answer:
•shouting•talking•singing•playing instruments•laughing•yelling•screaming•cryingExplanation:
yAn LNG po Alam ko e:^At the core of the differences between gender and sex is the chromosomal information transmitted at the moment a child is conceived. An "XY" chromosome generally means A) a heterosexual embryo B) a male embryo C) a hermaphrodite embryo OD) a female embryo
Answer:
B) male embryo
Explanation:
Tell me if you think caecilians are amphibians, reptiles, or fish.
Answer:
Amphibians
Explanation:
meaning of cell or cytology
Answer:
the smallest structural and functional unit of an organism, typically microscopic and consisting of cytoplasm and a nucleus enclosed in a membrane.
Explanation:
Cell is the building blocks of life.
Why is it we cannot directly observe a genotype, but can sometimes infer it?
PLZ HELP ME!!!!
2. What happens to sedimentary rocks on Earth’s surface?
Answer:
Sedimentary rock can change into metamorphic rock or into igneous rock. ... On Earth's surface, wind and water can break rock into pieces. They can also carry rock pieces to another place. Usually, the rock pieces, called sediments, drop from the wind or water to make a layer
Explanation:
Answer:
Sedimentary rocks are formed on or near the Earth's surface, in contrast to metamorphic and igneous rocks, which are formed deep within the Earth. ... Erosion and weathering transform boulders and even mountains into sediments, such as sand or mud. Dissolution is a form of weathering—chemical weathering.
Explanation:
What are the goals of binomial nomenclature and systematics?
Answer:
The goal of systematics is to organize living things into groups that have biological meaning. the science of naming and grouping organisms.
Explanation:
1. Place the letters in the correct order for DNA replication (a, b, c): ___
a. Daughter strands are formed using complementary base pairing.
b. DNA unwinds
c. The DNA of the daughter strands winds together with its parent strand.
2.Why is DNA replication called “semi-conservative”? ___
3.What enzyme unwinds or unzips the parent strand? ___
4.What enzyme connects the new bases to the old bases in the DNA template? ___
5.___DNA replication results in two DNA molecules,
a. each with two new strands
b. one with two new strands and one with 2 original strands
c. each with two original strands
d. each with one new strand and one original strand
6.___DNA replication is said to be semiconservative because:
a. both RNA and DNA synthesis are involved in the process.
b. part of the telomere is lost during each round of replication.
c. a new double helix contains one old and one new strand.
d. each new strand is complementary, not identical, to its template
Explanation:
1. b-a-c
2. Because in each of the new pair of double stranded DNA formed after replication, a parent strand is present in each.
3. Helicase
4. DNA Polymerase
5. Option D
6. Option C
what is the sequence of mRNA codons that are synthesized during transcription that go with TACCGGATGCCAGATCAAATC, TACGGGGGCGTAACCACAACT and TACCTGTTAAGCTACAAAATT?
Answer:
Tfftfxggfddsd
Explanation:
Because of the condons
HELLHELEPEGELLHELLPPPPPPPPP help please
If an acorn falls off a tree, is it living or non-living??
Answer: living
Acorns are still alive even off the tree and eventually grow into plants in the right conditions.
Answer:
Acorns are alive. Acorns live and breathe. Since they have no teeth and claws, acorns defend themselves with have chemicals called tannins. Because acorns decompose slowly, some gardeners compost them separately from other materials that break down more rapidly. Others grind them before composting them, as this speeds up decomposition.
therefore they are still living
Explanation:
brainliest?
How can the appearance of white baby rabbits be explained when the mother has white fur, and the father has black fur?
Explanation:
because the baby rabbit took after its mother and the
Which technique will researchers studying the inheritance patterns of various disorders most likely use? A. CLADOGRAM, B. DNA FINGERPRINTING, C. GEL ELECTROPHORESIS, D. CHROMOSOMAL ANALYSIS
Answer:
Chromosomal Analysis
Explanation:
Most of the options are pretty superficial but chromosomal analysis goes in depth therefore you'll get more results and find what could potentially be wrong.
The fan illustrated here plugs into the wall and blows air to make a room cool.
Which of the following best explains how it works?
A: It reduces heat by producing sound energy.
B: It gets chemical energy from gases in the air.
C: It transform electrical energy into the energy of motion.
D: It spins, sending heat and light energy through its wires.
Answer:
The only logical answer is C, the other ones don't make sense
Explanation:
I hope this helps! :)
What would happen if there is an obstruction in the vas deferens?
State one way by which Carbon Dioxide decreases in the atmosphere
Answer:
The early atmosphere was mainly carbon dioxide and water vapour. Water vapour condensed to form the oceans. Photosynthesis caused the amount of carbon dioxide to decrease and oxygen to increase.
Hope it helps!!!
Earth's crust is a thin layer made of
a rock
b metal
c liquid metal
d water
Answer:
a
Explanation:
If you find a fossil in two different locations and it has featured in common with dinosaurs and modern birds, how does this support the evolutionary theory?
a) the two species must not be related
b) looking at the fossils, they show similarities both physically and in their DNA that don't appear to change much over time
c) dinosaurs must have evolved from mammals because their bones are similar in size rather than birds
d) the land must have been together at one point where these two species interbred to share a common ancestor
what does not pass through the stomata of leaves
Carbon dioxide and oxygen cannot pass through but move in and out
Which of the following contain stem cells that produce most types of blood cells?
Bone Marrow
O Muscle cells
O Bile
O Plasma
An organ that makes and secretes hormones is called a
1] lung
2]gland
3]pancreas
4]thyroid
Answer: 2]gland brainliest?
Explanation:
A hypothetical phylogeny for marsupial relatedness is shown here. Macropodidae is the marsupial family. Which of these statements is supported by the phylogenetic tree shown here? Select ALL that apply.
A) M. bicolor and M. parma are in the same subspecies category. Eliminate
B) M. agilis and M. eugenii share the most recent common ancestor.
C) T. thetis and P. xanthpus share the most characteristics in common.
D) T. thetis and P. xanthpus share the greatest number of taxa levels than other species.
E) M. agilis and M. eugenii share the greatest number of taxa levels than other species.
Answer: B and E
Explanation: USATESTPREP
Help me with this please
Someone please help me !
Answer:
A
Explanation:
need help, will mark brainliest! plsss.
Which of the following is *not* a physiological mechanism regulated by timing?
Circadian rhythms in eukaryotes
Hibernation of animals during winter
Photoperiodism to direct the flowering of plants- i think its this one
Viral reproduction in a host cell
Hello, I Am BrotherEye
Answer: Physiological mechanisms explain any health-related events or outcomes. Physiological mechanisms can be altered voluntarily. For example, exercise causes alteration in the cardiac physiology of resting state. ... Multiple physiological mechanisms are responsible for survival of an individual.
Explanation:
It Is Simple Find The Answer Choice That Is The Opposite Of The One Above
In the 1960s, homeostatic regulatory mechanisms in physiology began to be used to describe what normally happens to the value of the regulated variable over time. The body does not possess a physiological sensor for detecting these
I hope that this helps