Answer:
The property that makes steel a good choice for sword-making is strength
Explanation:
The strength of a material is its ability to withstand an applied load or force without failure or plastic deformation. Types of strength of materials include; tensile strength, yield strength, torsional strength, compressional strength, shear strength.
Tensile strength of material is the ability of that material to withstand any force that tends to break or tear it apart. It is calculated by dividing the maximum amount of load or force the material can carry or withstand without breaking by the surface area of the material.
Mathematically, Tensile strength = Force/area
Its unit is Newton per meter squared, N/m².
Yield Strength In Steel
Yield strength is the maximum stress that can be applied before it begins to change shape permanently. Yield strength represents the upper limit of the load that can be safely applied to the meta beyond which it shape deforms.
Steel is an alloy of iron and carbon. It has many important and desirable properties such as durability, hardness and conductivity, and high tensile strength. However, the high strength of steel made a good choice for sword-making in the ancient past and even in the present.
Global Warming is not a thing!
Answer:
This is not an answer
Explanation:
In the water cycle, water returns to the ground as precipitation. How does phosphorus return to the soil in the phosphorus cycle?
A.
Phosphates found in soil dissolves in water.
B.
Phosphates are absorbed by the roots of plants.
C.
Animals eat the plants that absorbed the phosphates.
D.
Animals that ate the plants die and decompose.
Answer:
D
Explanation:
Why are elements called
the building blocks of matter?
A. They stack up nicely.
B. They make-up all matter.
C. They make-up most of the matter around us.
Answer:
B
Explanation:
I NEED HELP
1. What are chromosomes?
2. What are the four phases of mitosis, in the correct order?
3. In what phase of mitosis are chromosomes moving toward opposite sides
of the cell?
4. Compare the two nuclei that form as a result of mitosis?
5. What is cytokinesis, and when does it occur?
Answer:
1. a chromosome is a dna strand that has genes
2. prophase, metaphase, anaphase, telophase
3. anaphase
4. the two nuclei are identical daughter cells and they have the same number of chromosomes
5. this is when the cell separates forming two new daughter cells and it occurs in the late telophase of mitosis.
sorry if this is wrong but this is how i learned it! hope it helps!
Explanation:
I will mark brainest if you get it right
A photovoltaic cell captures ____ to be used for power.
A. Wind
B. Water
C. Coal
D. Sunlight
Answer:
D. Sunlight
Explanation:
Answer:
santa claus
Explanation:
What is the function of cholesterol?
to keep the cell membrane from falling apart
to line the arteries of organisms
to store energy
to give us quick energy
Answer:
to store energy
Explanation:
Its main function is to maintain the integrity and fluidity of cell membranes and to serve as a precursor for the synthesis of substances that are vital for the organism including steroid hormones, bile acids, and vitamin D. Cholesterol is essential for making a number of critical hormones, including the stress hormone cortisol. Cholesterol is also used to make the sex hormones testosterone, progesterone, and estrogen. 2 The liver also uses cholesterol to make bile, a fluid that plays a vital role in the processing and digestion of fats.
this is a cell not a plant, because the cell do not contain________
Answer:
Chloroplast.
Explanation:
This is what I believe it is since we're obviously talking about an animal cell and NOT a plant cell like it says. Animal cells do not contain chloroplast.
If this is the answer you're not looking for, let me know! Hope this helped! :)))
the process of which cells make proteins is called protein what?
this is a fill in the blank!
Answer:
protein biosynthesis
Explanation:
prove me wrong
Answer:
any of a class of nitrogenous organic compounds that consist of large molecules composed of one or more long chains of amino acids and are an essential part of all living organisms, especially as structural components of body tissues such as muscle, hair, collagen, etc.
Explanation:
what are the two main organs involved in the respiratory system?
Answer: The respiratory system is the network of organs and tissues that help you breathe. It includes your airways, lungs, and blood vessels. The muscles that power your lungs are also part of the respiratory system.
Explanation: Your respiratory system is the network of organs and tissues that help you breathe. This system helps your body absorb oxygen from the air so your organs can work. It also cleans waste gases, such as carbon dioxide, from your blood. Common problems include allergies, diseases or infections.
What is the respiratory system?
The respiratory system is the network of organs and tissues that help you breathe. It includes your airways, lungs, and blood vessels. The muscles that power your lungs are also part of the respiratory system. These parts work together to move oxygen throughout the body and clean out waste gases like carbon dioxide.
Why is sickle cell anemia so harmful to its carriers?
Answer: BECAUSE IT MAKES THE RED BLOOD CELLS SHRINK
Explanation:
Answer:
Sickle cell anemia is harmful to the body because it is enagering your spleen and with less healthy red blood cells circulating in the body, you can become chronically anemic.
Sickle cell anemia puts your body at more risk for infection.
Explanation:
As you observe an unknown cell under a microscope, you make the following observations..
Answer:
It is a plant cell that is being observed
Explanation:
With in the cell, there are chloroplasts that ONLY a plant cell has. It also has a cell wall which an animal cell does not, so it is clearly not an animal cell.
What is a niche, and how does it relate to evolution?
Answer:
The evolution of species’ niches is a process that is fundamental to investigations in numerous fields of biology, including speciation, community assembly, and long-term regional and global diversification processes. It forms the nexus between ecological and evolutionary questions. Topics as diverse as ecological speciation, niche conservatism, species coexistence, and historical biogeography all rely on interpreting patterns and drivers of species’ niches through time and across landscapes. Despite this importance, a distinct research agenda concerning niche evolution as a discrete topic of inquiry has yet to emerge. Niche evolution is often considered as a sidebar or of secondary importance when addressing questions such as “how did two species diverge?” Basic questions such as “what is a niche,” “what is the biological basis of niche evolution,” “at what scale should we evaluate niche evolution,” and “how can we observe niche evolution at different timescales” have rarely been addressed directly, or not at all in some systems. However, various intellectual threads connecting these ideas are evident in a number of recent and historical publications, giving some semblance of form to a framework for interpreting and evaluating niche evolution, and outlining major areas for future research from an evolutionary perspective. There is a reverse perspective from the macroecological scale as well, with questions involving coexistence, distributions and ranges, food webs, and other organismal attributes
Explanation:
ye
Which of these statements would be MOST important to include in an objective summary of the article?
A. The health triangle is a helpful tool for visualizing your total well-being.
B. Physical health represents your biological welfare and how to protect your body from illness or injury.
C. Consuming a well-balanced diet is one of the best ways to fuel your physical health.
D. You don't have to compete in Ultra-Marathons in order to reap the physical benefits of exercise.
Answer:
A
Explanation:
The spinal cord relays messages between the body and the brain. These messages control body functions like movement, bladder and bowel control and breathing. Each vertebra has a pair of spinal nerves that receive messages from the body (sensory impulses) and send messages to the body (motor impulses). The spinal nerves are numbered 1 to 55 from the neck down. The first eight as seen here are the vertebrate and send messages to the back of the head, neck, shoulders, arms, hands and diaphragm. A) cervical B) lumbar C) sacral D) thoracic
WILL GIVE BRAINLIEST!!!!!!!!!
In all living things, the presence of what structure supports the cell theory.
cell membrane
chloroplast
cell wall
vacuole
Answer:
chloroplast
Explanation:
What term describes parts of the body that are made from different kinds of cell
Answer:
The term that describes the parts of the body with different kindsof cells is organs, which in turn are made up of different tissues.
Explanation:
The cell is the structural and functional unit of all living beings, with the capacity to multiply and unite to form tissues.
Each tissue is a differentiated or specialized structure, formed by groups of cells of the same type, such as muscle, nerve, connective, cartilage and bone tissue, among others.
The specialized tissues in turn form organs, with specific structures and functions, such as muscle, brain and nerves or bones and joints. For this reason, organs are different body parts, formed by different kinds of cells.
Choose all the answers that apply.
Binary fission _____.
is the type of reproduction used by bacteria
occurs in organisms that do not have a membrane bound nucleus
is a type of sexual reproduction creates identical copies of the parent cell
is a type of asexual reproduction
Answer:
A, B, D
Explanation:
Binary fission occurs primarily in prokaryotes, but can occur in eukaryotes. It is used by bacteria and is asexual reproductio, not sexual.
Explanation:
occurs in organisms that do not have a membrane bound nucleus. Explanation: Binary fission is an asexual mode of reproduction. As it does not involve formation and fusion of gametes.
Some descriptions, such as color and odor, involve using your _____.
volume
measurements
senses
mass
Patterns of inheritance are usually more complicated than what is predicted by Mendelian genetics. Explain four possible exceptions to Mendelian genetics involving the inheritance patterns of a single gene and provide an example of each.
Answer:
Please find the explanation of the four possible exceptions to Mendelian genetics below.
Explanation:
Genetics, generally, has to do with how genes are inherited or transferred from parents to offsprings. Gregor Mendel, however, explained this concept in his principles of inheritance called Mendelian genetics. There are, however, exceptions to this mendelian principle called Non-mendelian pattern of inheritance i.e patterns of inheritance that do not follow Mendel's principles. Four of them are explained below:
- Incomplete dominance- This non-mendelian inheritance pattern occurs when one allele of a gene does not completely mask its allelic pair, but instead forms an intermediate phenotype. This is in contrast with Mendelian genetics that proposes complete dominance. For example, a red and white flower produce a pink flower (intermediate).
- Codominance- This is another non-mendelian inheritance where two alleles of a gene are simultaneously expressed. For example, roan cattles is a combination of both red and white hairs.
- Multiple alleles: Some traits in a population are controlled by more than two alleles, as explained in mendelian inheritance. Examples of trait controlled by multiple alleles is height in humans.
- Sex-linked inheritance: Some traits are controlled by genes on sex chromosomes i.e. X and Y chromosomes. This genes exhibit inheritance pattern that are different from Mendel's. Example is haemophilia disease controlled by an affected gene on the X-chromosome.
You overhear your mom and dad talking about having a well installed in your yard. What advice can you offer them about determining the placement and potential effectiveness of the well? Think about what you know about how wells factor into the groundwater systems running below the surface of the Earth.
Answer:
Built well where water table present nearer to surface.
Explanation:
My advice for them about determining the placement and potential effectiveness of the well is that the well should be installed where the groundwater present nearer to the surface, the reason behind this advice is that minimum work and energy will be used for digging well. If the water table is present very deep, more work and energy will be utilized on the digging of the well. Those areas where more rainfall occurs, the depth of water table is less as compared to arid zones because due to more rainfall more water goes inside the soil and the water table rises.
Which combination of atoms will form a molecule, but
not a compound?
O W and X
O X and Y
O W and Z
O Y and Z
HELP PLZZZZ
Answer:
but you did not give z
Explanation:
what is z
How Fast can you answer CORRECT how fast can i give you brainliest??? TWO answers explain your answer if its correct ill do a 100point question just for you:D..
HELP
Answer:
__B is the correct option__
One danger of excessive nitrogen levels in water is BLANK.
Answer:
light
Explanation:
excessive nitrogen can harm water bodies excessive nitrogen can cause overstimulation of growth of aquatic plants and algae excessive growth of the organisms intern can clogged water intakes used to solve oxygen as they decompose and block light to deeper waters
A group of researchers wants to develop an experiment to determine whether a new drug effectively treats cancer. The researchers want to inject the drug in hamsters first to determine whether there are any potentially serious side effects.
Part A: What are some possible ethical issues with this type of testing?
Part B: While conducting the experiment, the researchers find cancer stops spreading, and they declare the new drug is responsible. Is this a good assumption? Explain.
Answer:
Part A: The animals are used for examining and determining the effect of a particular new drug for the treatment of the diseases and disorders before they are examined over humans. This practice is called as clinical trial.
The ethical issue associated with given type of testing is that animals have right to live and survive. They should not be subjected to the treatment where they experience harm or even death.
Part B: Those assigned to the control take a sugar pill. The only thing you want to vary across groups when you're conducting an experiment is the treatment. Since taking pills is a part of taking medication (the treatment), medical experiments often employ something called a placebo-controlled study where outcomes for those who are randomly assigned to take the medication are compared to outcomes for those who are randomly assigned to take a sugar pill. The sugar pill is expected to have no effect, so it serves as a useful baseline to compare the treatment to.
Answer:
The current code of ethics to be upheld in science experiments are as follows: the experiment must contain a clear scientific purpose, the animals must be housed and provided with care, the animals must be legally acquired, the least amount of suffering must be ensured, and the animals can only be used when it is entirely necessary.
In this paragraph, we can see the plan does not fit the code of ethics entirely- because this is a new drug, we can not be sure that this experiment will not be fatal for the animals, and that they will not suffer tremendously before passing on. The medicine should be tested first on a sample which is not living.
Explanation:
Replication, Transcription, and Translation Chart
Please answer
DNA Replication:
1。Template Strand: Start with this nucleotide chain.
TACCCTTGAATAAAAAATCTCTGTTTGGTCGGTATTGTTGAAATC
2。Complementary DNA Strand: Write directly below template strand.
Transcription:
3。mRNA Strand: Write the complementary mRNA strand from the DNA template strand (#1).
Translation:
4。Anticodon: Write the anticodon sequence to match the mRNA strand (#3).
5。Protein Synthesis: Write the mRNA sequence that is complementary to the anticodons. Meaning the opposite code of the anticodons (#4).
6。Amino Acid Sequence: Create the amino acid sequence from protein synthesis using 3 letter abbreviation for amino acids (#5).
Answer:
jnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnn
Explanation:
Which type of cell transport occurs when there are an abundance of oxygen molecules
in the bloodstream, and they pass directly through phospholipids of the cell membrane
to enter cells?
Answer:
Diffusion
Explanation:
hope this helps!
At the beginning of the film, director Ron Howard shows two contrasting scenes: The deaths of the Apollo 1 crew and a party celebrating the landing of Apollo 11 on the moon. How do these scenes foreshadow the rest of the movie?
Answer:
It foreshadows that the Apollo 11 made it to the moon, while Apollo 1 did not
Explanation:
In non-mendelian genetics, humans have 4 blood types in which A and B are codominant and o is recessive. I cross two parents with type AB blood. What is the percentage of children with type B blood?
A. 0%
B. 25%
C. 50%
D. 100%
Answer:
i think it may be 50 dont be mad if im wrong
Explanation:
recessive takes over from what i read i dont see any o so it can be half a half b so 50...
Which of the following is NOT produced by
respiration
sugar
Ds ATP energy
carbon dioxide
water
Answer:
I think its water or sugar.
Please help me with this and answer correctly.
Brainliest will give!!
Answer:
Sorry can't help
Explanation:
PLEASE GIVE ME BRAINLIEST